\
| Variant ID: vg0618516900 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 18516900 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGTATCAACTTTTGGTGTACCTTGCCTCCTGGGACAAGGAATAATGCACGCACGTAAGGAACGCCCGTTGGGTTATTTCCGGTCGTGACAGCGATGGAAT[G/A]
CGCGCGCGGCGACGGGATGGCGACGGCGACGGCGCGGCAGTGGTGGTGCACGGCGCGAGGCGGCGATGGGATGCACGCGCGGCGCGAGGCGGGACGCGAC
GTCGCGTCCCGCCTCGCGCCGCGCGTGCATCCCATCGCCGCCTCGCGCCGTGCACCACCACTGCCGCGCCGTCGCCGTCGCCATCCCGTCGCCGCGCGCG[C/T]
ATTCCATCGCTGTCACGACCGGAAATAACCCAACGGGCGTTCCTTACGTGCGTGCATTATTCCTTGTCCCAGGAGGCAAGGTACACCAAAAGTTGATACA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.00% | 32.30% | 15.30% | 8.36% | NA |
| All Indica | 2759 | 63.70% | 9.00% | 20.55% | 6.78% | NA |
| All Japonica | 1512 | 5.40% | 81.50% | 6.08% | 7.01% | NA |
| Aus | 269 | 77.30% | 3.30% | 15.24% | 4.09% | NA |
| Indica I | 595 | 52.80% | 17.50% | 26.39% | 3.36% | NA |
| Indica II | 465 | 65.40% | 9.90% | 20.86% | 3.87% | NA |
| Indica III | 913 | 70.60% | 1.80% | 15.88% | 11.72% | NA |
| Indica Intermediate | 786 | 62.80% | 10.40% | 21.37% | 5.34% | NA |
| Temperate Japonica | 767 | 2.70% | 78.70% | 10.69% | 7.82% | NA |
| Tropical Japonica | 504 | 10.90% | 84.10% | 0.60% | 4.37% | NA |
| Japonica Intermediate | 241 | 2.50% | 84.60% | 2.90% | 9.96% | NA |
| VI/Aromatic | 96 | 3.10% | 4.20% | 9.38% | 83.33% | NA |
| Intermediate | 90 | 33.30% | 38.90% | 15.56% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0618516900 | G -> A | LOC_Os06g31880.1 | upstream_gene_variant ; 4466.0bp to feature; MODIFIER | silent_mutation | Average:47.023; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 | N | N | N | N |
| vg0618516900 | G -> A | LOC_Os06g31860.1 | downstream_gene_variant ; 3228.0bp to feature; MODIFIER | silent_mutation | Average:47.023; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 | N | N | N | N |
| vg0618516900 | G -> A | LOC_Os06g31870.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.023; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 | N | N | N | N |
| vg0618516900 | G -> DEL | N | N | silent_mutation | Average:47.023; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0618516900 | 1.41E-06 | NA | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618516900 | NA | 9.50E-15 | mr1276 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618516900 | 2.44E-06 | 5.35E-11 | mr1282 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618516900 | NA | 8.31E-09 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618516900 | 1.02E-06 | 1.25E-12 | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618516900 | 8.11E-07 | 4.68E-11 | mr1658 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618516900 | NA | 6.40E-06 | mr1658 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618516900 | NA | 5.31E-20 | mr1042_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618516900 | NA | 3.84E-19 | mr1276_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618516900 | 7.06E-06 | 9.65E-12 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618516900 | NA | 8.52E-06 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618516900 | NA | 2.26E-09 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618516900 | NA | 2.50E-08 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618516900 | NA | 1.08E-12 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618516900 | NA | 6.06E-06 | mr1667_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618516900 | NA | 6.52E-09 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618516900 | NA | 7.01E-15 | mr1686_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618516900 | NA | 3.16E-06 | mr1842_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |