\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618516900:

Variant ID: vg0618516900 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18516900
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTATCAACTTTTGGTGTACCTTGCCTCCTGGGACAAGGAATAATGCACGCACGTAAGGAACGCCCGTTGGGTTATTTCCGGTCGTGACAGCGATGGAAT[G/A]
CGCGCGCGGCGACGGGATGGCGACGGCGACGGCGCGGCAGTGGTGGTGCACGGCGCGAGGCGGCGATGGGATGCACGCGCGGCGCGAGGCGGGACGCGAC

Reverse complement sequence

GTCGCGTCCCGCCTCGCGCCGCGCGTGCATCCCATCGCCGCCTCGCGCCGTGCACCACCACTGCCGCGCCGTCGCCGTCGCCATCCCGTCGCCGCGCGCG[C/T]
ATTCCATCGCTGTCACGACCGGAAATAACCCAACGGGCGTTCCTTACGTGCGTGCATTATTCCTTGTCCCAGGAGGCAAGGTACACCAAAAGTTGATACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.00% 32.30% 15.30% 8.36% NA
All Indica  2759 63.70% 9.00% 20.55% 6.78% NA
All Japonica  1512 5.40% 81.50% 6.08% 7.01% NA
Aus  269 77.30% 3.30% 15.24% 4.09% NA
Indica I  595 52.80% 17.50% 26.39% 3.36% NA
Indica II  465 65.40% 9.90% 20.86% 3.87% NA
Indica III  913 70.60% 1.80% 15.88% 11.72% NA
Indica Intermediate  786 62.80% 10.40% 21.37% 5.34% NA
Temperate Japonica  767 2.70% 78.70% 10.69% 7.82% NA
Tropical Japonica  504 10.90% 84.10% 0.60% 4.37% NA
Japonica Intermediate  241 2.50% 84.60% 2.90% 9.96% NA
VI/Aromatic  96 3.10% 4.20% 9.38% 83.33% NA
Intermediate  90 33.30% 38.90% 15.56% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618516900 G -> A LOC_Os06g31880.1 upstream_gene_variant ; 4466.0bp to feature; MODIFIER silent_mutation Average:47.023; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 N N N N
vg0618516900 G -> A LOC_Os06g31860.1 downstream_gene_variant ; 3228.0bp to feature; MODIFIER silent_mutation Average:47.023; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 N N N N
vg0618516900 G -> A LOC_Os06g31870.1 intron_variant ; MODIFIER silent_mutation Average:47.023; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 N N N N
vg0618516900 G -> DEL N N silent_mutation Average:47.023; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618516900 1.41E-06 NA mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618516900 NA 9.50E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618516900 2.44E-06 5.35E-11 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618516900 NA 8.31E-09 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618516900 1.02E-06 1.25E-12 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618516900 8.11E-07 4.68E-11 mr1658 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618516900 NA 6.40E-06 mr1658 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618516900 NA 5.31E-20 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618516900 NA 3.84E-19 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618516900 7.06E-06 9.65E-12 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618516900 NA 8.52E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618516900 NA 2.26E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618516900 NA 2.50E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618516900 NA 1.08E-12 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618516900 NA 6.06E-06 mr1667_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618516900 NA 6.52E-09 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618516900 NA 7.01E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618516900 NA 3.16E-06 mr1842_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251