\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618487881:

Variant ID: vg0618487881 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18487881
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATCGTCTTCATCTCCCTCCTGGTAGTAGGCATAGGGATCCTCCGAAGCTTCATCTCCCGTTTCTGATTAATTTTATATTTGCAAGGGTGAGTACCAAC[T/C]
GTACTCAGCAAGCCACCACAGCAACAATGCATATGAAAGGGGTATTTCAAAGGATGGCTATGGCTCTTTTGCGCTAAGCCAGTTTTGTAATTCTTTTCAC

Reverse complement sequence

GTGAAAAGAATTACAAAACTGGCTTAGCGCAAAAGAGCCATAGCCATCCTTTGAAATACCCCTTTCATATGCATTGTTGCTGTGGTGGCTTGCTGAGTAC[A/G]
GTTGGTACTCACCCTTGCAAATATAAAATTAATCAGAAACGGGAGATGAAGCTTCGGAGGATCCCTATGCCTACTACCAGGAGGGAGATGAAGACGATGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.50% 4.00% 5.16% 50.40% NA
All Indica  2759 18.80% 0.10% 7.03% 74.05% NA
All Japonica  1512 86.70% 5.70% 0.33% 7.28% NA
Aus  269 14.50% 0.00% 15.24% 70.26% NA
Indica I  595 32.90% 0.00% 3.70% 63.36% NA
Indica II  465 16.80% 0.00% 5.16% 78.06% NA
Indica III  913 7.30% 0.20% 10.73% 81.71% NA
Indica Intermediate  786 22.50% 0.30% 6.36% 70.87% NA
Temperate Japonica  767 88.30% 6.30% 0.39% 5.08% NA
Tropical Japonica  504 84.70% 3.40% 0.20% 11.71% NA
Japonica Intermediate  241 85.90% 8.70% 0.41% 4.98% NA
VI/Aromatic  96 4.20% 88.50% 0.00% 7.29% NA
Intermediate  90 44.40% 14.40% 4.44% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618487881 T -> C LOC_Os06g31830.1 downstream_gene_variant ; 288.0bp to feature; MODIFIER silent_mutation Average:5.711; most accessible tissue: Zhenshan97 flag leaf, score: 10.769 N N N N
vg0618487881 T -> C LOC_Os06g31830-LOC_Os06g31840 intergenic_region ; MODIFIER silent_mutation Average:5.711; most accessible tissue: Zhenshan97 flag leaf, score: 10.769 N N N N
vg0618487881 T -> DEL N N silent_mutation Average:5.711; most accessible tissue: Zhenshan97 flag leaf, score: 10.769 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618487881 8.20E-06 NA mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618487881 1.36E-07 NA mr1281_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618487881 NA 4.33E-10 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618487881 8.14E-07 1.27E-15 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251