Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618475534:

Variant ID: vg0618475534 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 18475534
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACAACCGCACAACGGGCACAGGCGACACCGAAAGGACGAGGACGGGGCAGCGAAGGAGAGATCCTTACCACCACACGACGAGGCGAGGGAACGACAACGA[T/C]
GAACGGGCGCGGCGGAGACGGCCGGGAATGACGGAGACGAAAGGCGAGGGGACGACTTCGGCGGCGATCCTTGGACGAAGGTGAGACGCGGCCGGTGCAA

Reverse complement sequence

TTGCACCGGCCGCGTCTCACCTTCGTCCAAGGATCGCCGCCGAAGTCGTCCCCTCGCCTTTCGTCTCCGTCATTCCCGGCCGTCTCCGCCGCGCCCGTTC[A/G]
TCGTTGTCGTTCCCTCGCCTCGTCGTGTGGTGGTAAGGATCTCTCCTTCGCTGCCCCGTCCTCGTCCTTTCGGTGTCGCCTGTGCCCGTTGTGCGGTTGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.50%	19.70%	13.27%	23.51%	NA
All Indica	2759	22.90%	22.20%	18.74%	36.14%	NA
All Japonica	1512	86.80%	7.20%	1.92%	4.10%	NA
Aus	269	23.00%	37.50%	25.65%	13.75%	NA
Indica I	595	42.40%	21.30%	12.27%	24.03%	NA
Indica II	465	25.60%	14.80%	14.84%	44.73%	NA
Indica III	913	6.60%	25.40%	26.07%	41.95%	NA
Indica Intermediate	786	25.60%	23.50%	17.43%	33.46%	NA
Temperate Japonica	767	86.20%	8.30%	1.04%	4.43%	NA
Tropical Japonica	504	89.30%	4.60%	3.77%	2.38%	NA
Japonica Intermediate	241	83.40%	9.10%	0.83%	6.64%	NA
VI/Aromatic	96	3.10%	93.80%	2.08%	1.04%	NA
Intermediate	90	52.20%	21.10%	11.11%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0618475534	T -> C	LOC_Os06g31810.1	upstream_gene_variant ; 1315.0bp to feature; MODIFIER	silent_mutation	Average:18.383; most accessible tissue: Zhenshan97 flag leaf, score: 26.688	N	N	N	N
vg0618475534	T -> C	LOC_Os06g31820.1	intron_variant ; MODIFIER	silent_mutation	Average:18.383; most accessible tissue: Zhenshan97 flag leaf, score: 26.688	N	N	N	N
vg0618475534	T -> DEL	N	N	silent_mutation	Average:18.383; most accessible tissue: Zhenshan97 flag leaf, score: 26.688	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0618475534	4.42E-06	NA	mr1060_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618475534	8.64E-06	NA	mr1352_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618475534	NA	8.46E-06	mr1735_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251