Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618471057:

Variant ID: vg0618471057 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 18471057
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATGATAATATAATCTGTGTATGCATATCTCGTGCATAAATATTATAACCTATACAAATTTGCTTCCTTGGATGGATATAATGCAGAAACATTCAGGCAT[T/G]
CGGACCATGCTTATTGCACTAGCTTGTACAGTTGCACCTATACCTATTGTCAGAACAAGCATGGTGAAGTGAGGTGATCTAGCTAGTAAGGAAGTAGCAC

Reverse complement sequence

GTGCTACTTCCTTACTAGCTAGATCACCTCACTTCACCATGCTTGTTCTGACAATAGGTATAGGTGCAACTGTACAAGCTAGTGCAATAAGCATGGTCCG[A/C]
ATGCCTGAATGTTTCTGCATTATATCCATCCAAGGAAGCAAATTTGTATAGGTTATAATATTTATGCACGAGATATGCATACACAGATTATATTATCATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	14.90%	11.90%	21.24%	51.99%	NA
All Indica	2759	3.00%	4.50%	19.03%	73.47%	NA
All Japonica	1512	39.70%	21.70%	25.33%	13.23%	NA
Aus	269	0.70%	0.70%	25.28%	73.23%	NA
Indica I	595	7.70%	5.00%	34.29%	52.94%	NA
Indica II	465	2.80%	2.60%	22.37%	72.26%	NA
Indica III	913	0.80%	2.10%	5.81%	91.35%	NA
Indica Intermediate	786	2.30%	7.90%	20.87%	68.96%	NA
Temperate Japonica	767	59.80%	12.60%	20.34%	7.17%	NA
Tropical Japonica	504	12.70%	33.30%	32.74%	21.23%	NA
Japonica Intermediate	241	32.40%	26.10%	25.73%	15.77%	NA
VI/Aromatic	96	0.00%	93.80%	3.12%	3.12%	NA
Intermediate	90	18.90%	20.00%	27.78%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0618471057	T -> G	LOC_Os06g31800.1	upstream_gene_variant ; 2940.0bp to feature; MODIFIER	silent_mutation	Average:44.632; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0618471057	T -> G	LOC_Os06g31810.1	downstream_gene_variant ; 2639.0bp to feature; MODIFIER	silent_mutation	Average:44.632; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0618471057	T -> G	LOC_Os06g31820.1	downstream_gene_variant ; 3827.0bp to feature; MODIFIER	silent_mutation	Average:44.632; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0618471057	T -> G	LOC_Os06g31800-LOC_Os06g31810	intergenic_region ; MODIFIER	silent_mutation	Average:44.632; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0618471057	T -> DEL	N	N	silent_mutation	Average:44.632; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0618471057	NA	1.65E-08	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057	NA	1.15E-07	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057	NA	6.99E-06	mr1069	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057	NA	3.85E-06	mr1149	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057	NA	4.50E-13	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057	NA	1.32E-06	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057	NA	7.02E-10	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057	NA	9.14E-09	mr1330	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057	NA	7.69E-12	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057	NA	9.34E-06	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057	NA	9.76E-09	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057	NA	7.76E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057	NA	2.49E-07	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057	NA	2.58E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057	NA	7.42E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057	NA	3.29E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057	NA	3.79E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251