\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618471057:

Variant ID: vg0618471057 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18471057
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGATAATATAATCTGTGTATGCATATCTCGTGCATAAATATTATAACCTATACAAATTTGCTTCCTTGGATGGATATAATGCAGAAACATTCAGGCAT[T/G]
CGGACCATGCTTATTGCACTAGCTTGTACAGTTGCACCTATACCTATTGTCAGAACAAGCATGGTGAAGTGAGGTGATCTAGCTAGTAAGGAAGTAGCAC

Reverse complement sequence

GTGCTACTTCCTTACTAGCTAGATCACCTCACTTCACCATGCTTGTTCTGACAATAGGTATAGGTGCAACTGTACAAGCTAGTGCAATAAGCATGGTCCG[A/C]
ATGCCTGAATGTTTCTGCATTATATCCATCCAAGGAAGCAAATTTGTATAGGTTATAATATTTATGCACGAGATATGCATACACAGATTATATTATCATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 14.90% 11.90% 21.24% 51.99% NA
All Indica  2759 3.00% 4.50% 19.03% 73.47% NA
All Japonica  1512 39.70% 21.70% 25.33% 13.23% NA
Aus  269 0.70% 0.70% 25.28% 73.23% NA
Indica I  595 7.70% 5.00% 34.29% 52.94% NA
Indica II  465 2.80% 2.60% 22.37% 72.26% NA
Indica III  913 0.80% 2.10% 5.81% 91.35% NA
Indica Intermediate  786 2.30% 7.90% 20.87% 68.96% NA
Temperate Japonica  767 59.80% 12.60% 20.34% 7.17% NA
Tropical Japonica  504 12.70% 33.30% 32.74% 21.23% NA
Japonica Intermediate  241 32.40% 26.10% 25.73% 15.77% NA
VI/Aromatic  96 0.00% 93.80% 3.12% 3.12% NA
Intermediate  90 18.90% 20.00% 27.78% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618471057 T -> G LOC_Os06g31800.1 upstream_gene_variant ; 2940.0bp to feature; MODIFIER silent_mutation Average:44.632; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0618471057 T -> G LOC_Os06g31810.1 downstream_gene_variant ; 2639.0bp to feature; MODIFIER silent_mutation Average:44.632; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0618471057 T -> G LOC_Os06g31820.1 downstream_gene_variant ; 3827.0bp to feature; MODIFIER silent_mutation Average:44.632; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0618471057 T -> G LOC_Os06g31800-LOC_Os06g31810 intergenic_region ; MODIFIER silent_mutation Average:44.632; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0618471057 T -> DEL N N silent_mutation Average:44.632; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618471057 NA 1.65E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057 NA 1.15E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057 NA 6.99E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057 NA 3.85E-06 mr1149 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057 NA 4.50E-13 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057 NA 1.32E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057 NA 7.02E-10 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057 NA 9.14E-09 mr1330 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057 NA 7.69E-12 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057 NA 9.34E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057 NA 9.76E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057 NA 7.76E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057 NA 2.49E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057 NA 2.58E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057 NA 7.42E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057 NA 3.29E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618471057 NA 3.79E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251