\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618366551:

Variant ID: vg0618366551 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18366551
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.54, T: 0.46, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCCTCCGCTTCTTCATCCTCATGCTGTCATTCCTCTTTCTTACCAGCATATCCGGCGGTGCCAAGCCGGTGCGGATGCTGGTTCTTGGTCTGGAGCAA[T/G]
CGATATGCCTCGCTTCTAGCTTTGGACTCGGGGGTCGACTTCTTCGCATGGAATTCCTCCTAGACTTGTTCCGTGATCCAAGGAAATTTCTCTCTTAGAT

Reverse complement sequence

ATCTAAGAGAGAAATTTCCTTGGATCACGGAACAAGTCTAGGAGGAATTCCATGCGAAGAAGTCGACCCCCGAGTCCAAAGCTAGAAGCGAGGCATATCG[A/C]
TTGCTCCAGACCAAGAACCAGCATCCGCACCGGCTTGGCACCGCCGGATATGCTGGTAAGAAAGAGGAATGACAGCATGAGGATGAAGAAGCGGAGGAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.80% 16.60% 7.05% 32.59% NA
All Indica  2759 25.70% 24.20% 7.87% 42.26% NA
All Japonica  1512 75.80% 0.70% 2.98% 20.50% NA
Aus  269 24.50% 36.10% 23.42% 15.99% NA
Indica I  595 45.50% 15.60% 6.89% 31.93% NA
Indica II  465 29.00% 10.10% 5.81% 55.05% NA
Indica III  913 7.00% 37.90% 10.51% 44.58% NA
Indica Intermediate  786 30.40% 23.00% 6.74% 39.82% NA
Temperate Japonica  767 73.10% 0.10% 1.56% 25.16% NA
Tropical Japonica  504 86.10% 0.40% 1.79% 11.71% NA
Japonica Intermediate  241 62.70% 3.30% 9.96% 24.07% NA
VI/Aromatic  96 96.90% 0.00% 1.04% 2.08% NA
Intermediate  90 62.20% 8.90% 7.78% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618366551 T -> G LOC_Os06g31570.1 downstream_gene_variant ; 3348.0bp to feature; MODIFIER silent_mutation Average:6.387; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N
vg0618366551 T -> G LOC_Os06g31580.1 downstream_gene_variant ; 60.0bp to feature; MODIFIER silent_mutation Average:6.387; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N
vg0618366551 T -> G LOC_Os06g31589.1 downstream_gene_variant ; 4083.0bp to feature; MODIFIER silent_mutation Average:6.387; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N
vg0618366551 T -> G LOC_Os06g31570-LOC_Os06g31580 intergenic_region ; MODIFIER silent_mutation Average:6.387; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N
vg0618366551 T -> DEL N N silent_mutation Average:6.387; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618366551 NA 1.87E-09 mr1033 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618366551 NA 1.80E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618366551 NA 2.94E-06 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618366551 NA 4.82E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618366551 NA 7.20E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618366551 NA 7.98E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618366551 NA 8.67E-06 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618366551 NA 8.32E-07 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618366551 NA 3.87E-07 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618366551 NA 2.52E-09 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618366551 NA 6.65E-06 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618366551 NA 2.79E-08 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618366551 NA 2.09E-21 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618366551 NA 7.10E-06 mr1993 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618366551 2.25E-06 8.92E-07 mr1091_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618366551 NA 1.03E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618366551 NA 2.84E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618366551 NA 1.07E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618366551 NA 2.60E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618366551 NA 1.71E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618366551 NA 1.73E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251