Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618247340:

Variant ID: vg0618247340 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 18247340
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAGTATGGGCACTACGCCAACAACTGCCCTCATCCACGCAAAACTCCTGTCCATACTAGCGCTAATGCAATGACTGTTCGTGGAACTACTACCCCTGCT[G/A]
CCGGACGAGGACTATTCAAGACTCCGCAAACTAACAGGACCGCTACCGGATTTGGACGTGGACAAGTGAACCATGTTCGAGCTGAAGAGGCCCAGGAAGA

Reverse complement sequence

TCTTCCTGGGCCTCTTCAGCTCGAACATGGTTCACTTGTCCACGTCCAAATCCGGTAGCGGTCCTGTTAGTTTGCGGAGTCTTGAATAGTCCTCGTCCGG[C/T]
AGCAGGGGTAGTAGTTCCACGAACAGTCATTGCATTAGCGCTAGTATGGACAGGAGTTTTGCGTGGATGAGGGCAGTTGTTGGCGTAGTGCCCATACTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.10%	1.80%	0.61%	1.44%	NA
All Indica	2759	99.60%	0.00%	0.33%	0.04%	NA
All Japonica	1512	88.80%	5.50%	1.26%	4.43%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.80%	0.00%	1.01%	0.17%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.00%	0.25%	0.00%	NA
Temperate Japonica	767	79.70%	10.40%	1.96%	7.95%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	94.60%	1.20%	1.66%	2.49%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	1.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0618247340	G -> A	LOC_Os06g31350.1	missense_variant ; p.Ala605Thr; MODERATE	nonsynonymous_codon ; A605T	Average:22.465; most accessible tissue: Minghui63 young leaf, score: 42.042	unknown	unknown	TOLERATED	0.10
vg0618247340	G -> DEL	LOC_Os06g31350.1	N	frameshift_variant	Average:22.465; most accessible tissue: Minghui63 young leaf, score: 42.042	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0618247340	3.55E-07	NA	mr1071	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340	NA	4.14E-07	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340	NA	5.59E-06	mr1619	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340	NA	4.51E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340	NA	4.03E-08	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340	NA	6.11E-07	mr1167_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340	NA	1.45E-06	mr1456_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340	NA	1.25E-07	mr1456_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340	NA	3.40E-07	mr1565_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340	NA	1.11E-07	mr1624_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340	NA	2.32E-06	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340	NA	3.71E-07	mr1726_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340	NA	5.89E-06	mr1736_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340	NA	1.83E-07	mr1780_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251