\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618247340:

Variant ID: vg0618247340 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18247340
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAGTATGGGCACTACGCCAACAACTGCCCTCATCCACGCAAAACTCCTGTCCATACTAGCGCTAATGCAATGACTGTTCGTGGAACTACTACCCCTGCT[G/A]
CCGGACGAGGACTATTCAAGACTCCGCAAACTAACAGGACCGCTACCGGATTTGGACGTGGACAAGTGAACCATGTTCGAGCTGAAGAGGCCCAGGAAGA

Reverse complement sequence

TCTTCCTGGGCCTCTTCAGCTCGAACATGGTTCACTTGTCCACGTCCAAATCCGGTAGCGGTCCTGTTAGTTTGCGGAGTCTTGAATAGTCCTCGTCCGG[C/T]
AGCAGGGGTAGTAGTTCCACGAACAGTCATTGCATTAGCGCTAGTATGGACAGGAGTTTTGCGTGGATGAGGGCAGTTGTTGGCGTAGTGCCCATACTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.10% 1.80% 0.61% 1.44% NA
All Indica  2759 99.60% 0.00% 0.33% 0.04% NA
All Japonica  1512 88.80% 5.50% 1.26% 4.43% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 0.00% 1.01% 0.17% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.00% 0.25% 0.00% NA
Temperate Japonica  767 79.70% 10.40% 1.96% 7.95% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 94.60% 1.20% 1.66% 2.49% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618247340 G -> A LOC_Os06g31350.1 missense_variant ; p.Ala605Thr; MODERATE nonsynonymous_codon ; A605T Average:22.465; most accessible tissue: Minghui63 young leaf, score: 42.042 unknown unknown TOLERATED 0.10
vg0618247340 G -> DEL LOC_Os06g31350.1 N frameshift_variant Average:22.465; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618247340 3.55E-07 NA mr1071 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340 NA 4.14E-07 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340 NA 5.59E-06 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340 NA 4.51E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340 NA 4.03E-08 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340 NA 6.11E-07 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340 NA 1.45E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340 NA 1.25E-07 mr1456_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340 NA 3.40E-07 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340 NA 1.11E-07 mr1624_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340 NA 2.32E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340 NA 3.71E-07 mr1726_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340 NA 5.89E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618247340 NA 1.83E-07 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251