\
| Variant ID: vg0618212179 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 18212179 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATGTAAATTGCACATCAAATTTAAATGCGGCAAATAAATGAGAGAAGGAGACAAGAGATTTTTCACCGAGATTCAGAAACTTGCCGGTTTCCTACTCCC[C/T]
GTTGAGATGAGCCCAACTCCACCGCTCAACCACGAAGCCACTGCATGCCCCCTTCGTCAAGGGGTGGGCAAGGCGGGAGCCGGCCCACAGAGAGGACTAC
GTAGTCCTCTCTGTGGGCCGGCTCCCGCCTTGCCCACCCCTTGACGAAGGGGGCATGCAGTGGCTTCGTGGTTGAGCGGTGGAGTTGGGCTCATCTCAAC[G/A]
GGGAGTAGGAAACCGGCAAGTTTCTGAATCTCGGTGAAAAATCTCTTGTCTCCTTCTCTCATTTATTTGCCGCATTTAAATTTGATGTGCAATTTACATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.00% | 13.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 90.50% | 9.50% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 78.40% | 21.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.50% | 14.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 87.30% | 12.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 67.50% | 32.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.20% | 22.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0618212179 | C -> T | LOC_Os06g31290-LOC_Os06g31300 | intergenic_region ; MODIFIER | silent_mutation | Average:48.768; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0618212179 | NA | 4.28E-06 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618212179 | NA | 2.09E-06 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618212179 | NA | 8.15E-06 | mr1835 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618212179 | NA | 1.63E-07 | mr1043_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618212179 | NA | 1.23E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618212179 | NA | 6.77E-06 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618212179 | NA | 9.41E-06 | mr1269_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618212179 | NA | 4.29E-06 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618212179 | 3.42E-06 | 4.15E-08 | mr1291_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618212179 | NA | 5.88E-06 | mr1291_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618212179 | NA | 5.71E-07 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618212179 | NA | 3.07E-07 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618212179 | NA | 9.95E-06 | mr1543_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618212179 | NA | 1.73E-08 | mr1624_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618212179 | NA | 5.76E-06 | mr1726_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618212179 | NA | 9.50E-06 | mr1736_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618212179 | NA | 4.41E-06 | mr1740_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618212179 | NA | 1.94E-06 | mr1741_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618212179 | NA | 9.05E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618212179 | NA | 1.18E-07 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618212179 | NA | 7.05E-06 | mr1792_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |