\
| Variant ID: vg0618172241 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 18172241 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 263. )
TGGTTGCGGTTGAGGATTACATTTCTTGCGGTTTTCTTCCTCCACCCTCCGAATTTCTTCTTCTCGTCTTGAACTTTTATGGCCTTTCCTTGCTTCACCT[A/G]
AACCCCAATTCCATCGCATTCCTCAGTATCTTCTCTTATCTTTGTGAGGCCTACATTGGGGTAGAGCCATTCCTTGATCTCTTCTGTTTTTACTACGAGT
ACTCGTAGTAAAAACAGAAGAGATCAAGGAATGGCTCTACCCCAATGTAGGCCTCACAAAGATAAGAGAAGATACTGAGGAATGCGATGGAATTGGGGTT[T/C]
AGGTGAAGCAAGGAAAGGCCATAAAAGTTCAAGACGAGAAGAAGAAATTCGGAGGGTGGAGGAAGAAAACCGCAAGAAATGTAATCCTCAACCGCAACCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.80% | 29.00% | 1.93% | 8.25% | NA |
| All Indica | 2759 | 85.30% | 13.80% | 0.58% | 0.25% | NA |
| All Japonica | 1512 | 8.50% | 61.60% | 4.76% | 25.13% | NA |
| Aus | 269 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.00% | 13.80% | 1.18% | 1.01% | NA |
| Indica II | 465 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 82.60% | 17.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 83.60% | 15.40% | 0.89% | 0.13% | NA |
| Temperate Japonica | 767 | 7.60% | 54.60% | 7.56% | 30.25% | NA |
| Tropical Japonica | 504 | 10.70% | 82.10% | 0.79% | 6.35% | NA |
| Japonica Intermediate | 241 | 7.10% | 40.70% | 4.15% | 48.13% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 31.10% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0618172241 | A -> G | LOC_Os06g31240.1 | synonymous_variant ; p.Leu77Leu; LOW | synonymous_codon | Average:50.857; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 | N | N | N | N |
| vg0618172241 | A -> DEL | LOC_Os06g31240.1 | N | frameshift_variant | Average:50.857; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0618172241 | NA | 9.51E-06 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618172241 | NA | 4.67E-06 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618172241 | NA | 3.18E-12 | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618172241 | NA | 9.38E-06 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618172241 | NA | 8.19E-13 | mr1354 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618172241 | NA | 8.80E-06 | mr1821 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618172241 | NA | 5.14E-06 | mr1912 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618172241 | NA | 3.52E-07 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618172241 | NA | 8.59E-12 | mr1138_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618172241 | NA | 2.05E-07 | mr1155_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618172241 | NA | 7.05E-06 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618172241 | NA | 3.18E-06 | mr1291_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618172241 | NA | 1.06E-12 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |