\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618168177:

Variant ID: vg0618168177 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18168177
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


GAAACTTTGTGAAAATTGCACCAGCTTCCATGTTAGAAACTTTGTTTCAGAAAGCTCAGAAAATTAGAAAATGCTGCGATGAAACAATTAATGTGCTCAA[G/A]
TTTTTGAGATGGAAACCGGCGCTCAAAAACTTTGTAAAATTTTGGATGCTCTTTTTTAATTATTTGGTTAGAGAAAGGTATTTTTTTACCCGGCCTCTAT

Reverse complement sequence

ATAGAGGCCGGGTAAAAAAATACCTTTCTCTAACCAAATAATTAAAAAAGAGCATCCAAAATTTTACAAAGTTTTTGAGCGCCGGTTTCCATCTCAAAAA[C/T]
TTGAGCACATTAATTGTTTCATCGCAGCATTTTCTAATTTTCTGAGCTTTCTGAAACAAAGTTTCTAACATGGAAGCTGGTGCAATTTTCACAAAGTTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 38.40% 0.28% 10.54% NA
All Indica  2759 80.40% 18.90% 0.22% 0.51% NA
All Japonica  1512 2.80% 65.20% 0.33% 31.68% NA
Aus  269 37.20% 62.80% 0.00% 0.00% NA
Indica I  595 80.00% 17.80% 0.50% 1.68% NA
Indica II  465 94.00% 6.00% 0.00% 0.00% NA
Indica III  913 78.20% 21.50% 0.33% 0.00% NA
Indica Intermediate  786 75.10% 24.40% 0.00% 0.51% NA
Temperate Japonica  767 3.80% 55.10% 0.65% 40.42% NA
Tropical Japonica  504 1.00% 91.90% 0.00% 7.14% NA
Japonica Intermediate  241 3.30% 41.50% 0.00% 55.19% NA
VI/Aromatic  96 1.00% 97.90% 0.00% 1.04% NA
Intermediate  90 44.40% 48.90% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618168177 G -> A LOC_Os06g31220.1 upstream_gene_variant ; 2881.0bp to feature; MODIFIER silent_mutation Average:52.166; most accessible tissue: Callus, score: 78.086 N N N N
vg0618168177 G -> A LOC_Os06g31230.1 upstream_gene_variant ; 349.0bp to feature; MODIFIER silent_mutation Average:52.166; most accessible tissue: Callus, score: 78.086 N N N N
vg0618168177 G -> A LOC_Os06g31240.1 upstream_gene_variant ; 3834.0bp to feature; MODIFIER silent_mutation Average:52.166; most accessible tissue: Callus, score: 78.086 N N N N
vg0618168177 G -> A LOC_Os06g31220-LOC_Os06g31230 intergenic_region ; MODIFIER silent_mutation Average:52.166; most accessible tissue: Callus, score: 78.086 N N N N
vg0618168177 G -> DEL N N silent_mutation Average:52.166; most accessible tissue: Callus, score: 78.086 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618168177 NA 3.17E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618168177 NA 1.70E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618168177 NA 1.30E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618168177 NA 2.70E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618168177 NA 3.09E-09 mr1624 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618168177 NA 2.31E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618168177 NA 2.16E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618168177 NA 2.02E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618168177 NA 1.52E-07 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618168177 NA 2.06E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618168177 NA 9.91E-07 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618168177 NA 3.80E-06 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618168177 NA 2.23E-07 mr1624_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618168177 NA 2.31E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251