\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618101294:

Variant ID: vg0618101294 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18101294
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.08, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


ATATTGATTAATTACTACAATTGTTTTACTGTTTTCAACTACTGCTTTTAAATGCCTGCTTTATTGCAAAAGAACCCCTAGCCTCCTTTGGTTATATCCT[A/G]
CATCATACCTCCCCTTCCGGTATGACTTGCTGAGTACAGTGGGTAGTACTCAGTCTTGCTCTCTTTTCCCCCATACCAGAGCTGAAGATCTTCCTAGTGG

Reverse complement sequence

CCACTAGGAAGATCTTCAGCTCTGGTATGGGGGAAAAGAGAGCAAGACTGAGTACTACCCACTGTACTCAGCAAGTCATACCGGAAGGGGAGGTATGATG[T/C]
AGGATATAACCAAAGGAGGCTAGGGGTTCTTTTGCAATAAAGCAGGCATTTAAAAGCAGTAGTTGAAAACAGTAAAACAATTGTAGTAATTAATCAATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.00% 32.30% 1.67% 0.11% NA
All Indica  2759 94.10% 3.00% 2.79% 0.18% NA
All Japonica  1512 6.70% 93.30% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 93.40% 2.40% 4.20% 0.00% NA
Indica II  465 94.80% 3.90% 1.29% 0.00% NA
Indica III  913 97.70% 1.10% 1.20% 0.00% NA
Indica Intermediate  786 89.80% 5.10% 4.45% 0.64% NA
Temperate Japonica  767 3.70% 96.30% 0.00% 0.00% NA
Tropical Japonica  504 12.90% 87.10% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 64.40% 33.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618101294 A -> G LOC_Os06g31150.1 upstream_gene_variant ; 3502.0bp to feature; MODIFIER silent_mutation Average:53.823; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0618101294 A -> G LOC_Os06g31160.1 upstream_gene_variant ; 1149.0bp to feature; MODIFIER silent_mutation Average:53.823; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0618101294 A -> G LOC_Os06g31150-LOC_Os06g31160 intergenic_region ; MODIFIER silent_mutation Average:53.823; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0618101294 A -> DEL N N silent_mutation Average:53.823; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618101294 7.35E-12 1.00E-79 mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618101294 1.14E-07 NA mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618101294 NA 8.28E-80 mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618101294 NA 3.06E-90 mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618101294 1.25E-06 3.61E-41 mr1176 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618101294 4.05E-06 2.94E-08 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618101294 NA 9.46E-96 mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618101294 NA 7.96E-89 mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618101294 NA 6.70E-36 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618101294 NA 5.39E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618101294 4.95E-08 2.93E-72 mr1536 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618101294 1.08E-07 1.08E-07 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618101294 NA 3.07E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618101294 NA 7.50E-34 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618101294 1.93E-12 2.94E-108 mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618101294 NA 5.67E-21 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618101294 NA 2.16E-61 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618101294 2.13E-12 1.00E-96 mr1536_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618101294 6.07E-09 1.54E-10 mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618101294 NA 1.11E-06 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251