Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618092647:

Variant ID: vg0618092647 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 18092647
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

GAAACAAAGATGTTGTCGGCCGCATTGCAAAATGGGTAGTCGAGCTAAGTCAGTTTGATGTCCACTTTGTGCCATGAACAACTATTAAGTCCCAAGTCCT[C/T]
GCTGATTTTGTAGCCGACTGGACTATGCCTAAGAACAGGTCAGACAGTCAAACGGACAGCGAAACATGGACAATGGCGTTCGACGGCGCACTCAACAGCC

Reverse complement sequence

GGCTGTTGAGTGCGCCGTCGAACGCCATTGTCCATGTTTCGCTGTCCGTTTGACTGTCTGACCTGTTCTTAGGCATAGTCCAGTCGGCTACAAAATCAGC[G/A]
AGGACTTGGGACTTAATAGTTGTTCATGGCACAAAGTGGACATCAAACTGACTTAGCTCGACTACCCATTTTGCAATGCGGCCGACAACATCTTTGTTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.00%	8.20%	1.86%	0.00%	NA
All Indica	2759	83.20%	13.70%	3.04%	0.00%	NA
All Japonica	1512	99.70%	0.20%	0.07%	0.00%	NA
Aus	269	98.90%	0.40%	0.74%	0.00%	NA
Indica I	595	91.10%	3.70%	5.21%	0.00%	NA
Indica II	465	88.40%	8.60%	3.01%	0.00%	NA
Indica III	913	75.10%	23.80%	1.10%	0.00%	NA
Indica Intermediate	786	83.60%	12.70%	3.69%	0.00%	NA
Temperate Japonica	767	99.50%	0.40%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	3.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0618092647	C -> T	LOC_Os06g31140.1	upstream_gene_variant ; 73.0bp to feature; MODIFIER	silent_mutation	Average:45.723; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0618092647	C -> T	LOC_Os06g31110.1	downstream_gene_variant ; 4165.0bp to feature; MODIFIER	silent_mutation	Average:45.723; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0618092647	C -> T	LOC_Os06g31120.1	downstream_gene_variant ; 1347.0bp to feature; MODIFIER	silent_mutation	Average:45.723; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0618092647	C -> T	LOC_Os06g31130.1	downstream_gene_variant ; 499.0bp to feature; MODIFIER	silent_mutation	Average:45.723; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0618092647	C -> T	LOC_Os06g31150.1	downstream_gene_variant ; 2446.0bp to feature; MODIFIER	silent_mutation	Average:45.723; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0618092647	C -> T	LOC_Os06g31130-LOC_Os06g31140	intergenic_region ; MODIFIER	silent_mutation	Average:45.723; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0618092647	3.01E-06	NA	mr1096	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647	NA	4.05E-08	mr1695	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647	1.19E-06	NA	mr1065_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647	5.66E-07	NA	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647	1.20E-08	NA	mr1087_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647	2.70E-08	8.81E-07	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647	5.40E-06	NA	mr1091_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647	8.33E-07	NA	mr1094_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647	9.55E-07	NA	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647	9.77E-06	NA	mr1096_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647	8.82E-07	NA	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647	3.13E-06	NA	mr1111_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647	4.05E-08	NA	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647	2.76E-06	NA	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647	5.98E-06	NA	mr1144_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647	6.51E-08	NA	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647	4.93E-06	NA	mr1200_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647	3.64E-06	NA	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647	7.82E-06	NA	mr1234_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251