\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618092647:

Variant ID: vg0618092647 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18092647
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


GAAACAAAGATGTTGTCGGCCGCATTGCAAAATGGGTAGTCGAGCTAAGTCAGTTTGATGTCCACTTTGTGCCATGAACAACTATTAAGTCCCAAGTCCT[C/T]
GCTGATTTTGTAGCCGACTGGACTATGCCTAAGAACAGGTCAGACAGTCAAACGGACAGCGAAACATGGACAATGGCGTTCGACGGCGCACTCAACAGCC

Reverse complement sequence

GGCTGTTGAGTGCGCCGTCGAACGCCATTGTCCATGTTTCGCTGTCCGTTTGACTGTCTGACCTGTTCTTAGGCATAGTCCAGTCGGCTACAAAATCAGC[G/A]
AGGACTTGGGACTTAATAGTTGTTCATGGCACAAAGTGGACATCAAACTGACTTAGCTCGACTACCCATTTTGCAATGCGGCCGACAACATCTTTGTTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.00% 8.20% 1.86% 0.00% NA
All Indica  2759 83.20% 13.70% 3.04% 0.00% NA
All Japonica  1512 99.70% 0.20% 0.07% 0.00% NA
Aus  269 98.90% 0.40% 0.74% 0.00% NA
Indica I  595 91.10% 3.70% 5.21% 0.00% NA
Indica II  465 88.40% 8.60% 3.01% 0.00% NA
Indica III  913 75.10% 23.80% 1.10% 0.00% NA
Indica Intermediate  786 83.60% 12.70% 3.69% 0.00% NA
Temperate Japonica  767 99.50% 0.40% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618092647 C -> T LOC_Os06g31140.1 upstream_gene_variant ; 73.0bp to feature; MODIFIER silent_mutation Average:45.723; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg0618092647 C -> T LOC_Os06g31110.1 downstream_gene_variant ; 4165.0bp to feature; MODIFIER silent_mutation Average:45.723; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg0618092647 C -> T LOC_Os06g31120.1 downstream_gene_variant ; 1347.0bp to feature; MODIFIER silent_mutation Average:45.723; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg0618092647 C -> T LOC_Os06g31130.1 downstream_gene_variant ; 499.0bp to feature; MODIFIER silent_mutation Average:45.723; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg0618092647 C -> T LOC_Os06g31150.1 downstream_gene_variant ; 2446.0bp to feature; MODIFIER silent_mutation Average:45.723; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg0618092647 C -> T LOC_Os06g31130-LOC_Os06g31140 intergenic_region ; MODIFIER silent_mutation Average:45.723; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618092647 3.01E-06 NA mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647 NA 4.05E-08 mr1695 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647 1.19E-06 NA mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647 5.66E-07 NA mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647 1.20E-08 NA mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647 2.70E-08 8.81E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647 5.40E-06 NA mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647 8.33E-07 NA mr1094_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647 9.55E-07 NA mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647 9.77E-06 NA mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647 8.82E-07 NA mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647 3.13E-06 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647 4.05E-08 NA mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647 2.76E-06 NA mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647 5.98E-06 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647 6.51E-08 NA mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647 4.93E-06 NA mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647 3.64E-06 NA mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618092647 7.82E-06 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251