\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618089803:

Variant ID: vg0618089803 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18089803
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAGTTGGTTCCACCTTACTAAACTAAACTAGTAAGGTGGTACTAAACATGCGTACAAAAGTTCTCAAGGACCACACATACCAAATCCTAATTGGGACA[A/G]
GATGTCACAAACACCAGATTGTCCGCCCAAGTCAATTTAGCAACAAGGATGGTTGCTAGCTTCGACACCTGTCGCCTCCTCTCACGCGTCCCCGGGAGCC

Reverse complement sequence

GGCTCCCGGGGACGCGTGAGAGGAGGCGACAGGTGTCGAAGCTAGCAACCATCCTTGTTGCTAAATTGACTTGGGCGGACAATCTGGTGTTTGTGACATC[T/C]
TGTCCCAATTAGGATTTGGTATGTGTGGTCCTTGAGAACTTTTGTACGCATGTTTAGTACCACCTTACTAGTTTAGTTTAGTAAGGTGGAACCAACTTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.70% 32.10% 0.06% 0.13% NA
All Indica  2759 97.00% 2.80% 0.07% 0.18% NA
All Japonica  1512 6.70% 93.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.50% 2.40% 0.00% 0.17% NA
Indica II  465 95.90% 3.70% 0.22% 0.22% NA
Indica III  913 99.00% 0.90% 0.00% 0.11% NA
Indica Intermediate  786 94.80% 4.80% 0.13% 0.25% NA
Temperate Japonica  767 3.80% 96.20% 0.00% 0.00% NA
Tropical Japonica  504 12.90% 87.10% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 64.40% 33.30% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618089803 A -> G LOC_Os06g31100.1 upstream_gene_variant ; 3103.0bp to feature; MODIFIER silent_mutation Average:58.684; most accessible tissue: Callus, score: 75.311 N N N N
vg0618089803 A -> G LOC_Os06g31130.1 upstream_gene_variant ; 1749.0bp to feature; MODIFIER silent_mutation Average:58.684; most accessible tissue: Callus, score: 75.311 N N N N
vg0618089803 A -> G LOC_Os06g31140.1 upstream_gene_variant ; 2917.0bp to feature; MODIFIER silent_mutation Average:58.684; most accessible tissue: Callus, score: 75.311 N N N N
vg0618089803 A -> G LOC_Os06g31110.1 downstream_gene_variant ; 1321.0bp to feature; MODIFIER silent_mutation Average:58.684; most accessible tissue: Callus, score: 75.311 N N N N
vg0618089803 A -> G LOC_Os06g31120.1 intron_variant ; MODIFIER silent_mutation Average:58.684; most accessible tissue: Callus, score: 75.311 N N N N
vg0618089803 A -> DEL N N silent_mutation Average:58.684; most accessible tissue: Callus, score: 75.311 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618089803 1.15E-11 2.89E-78 mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618089803 2.50E-09 6.78E-13 mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618089803 NA 8.31E-06 mr1091 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618089803 NA 2.32E-34 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618089803 NA 4.89E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618089803 NA 6.61E-39 mr1176 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618089803 NA 4.77E-29 mr1223 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618089803 NA 1.09E-06 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618089803 NA 2.37E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618089803 NA 3.61E-35 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618089803 NA 1.87E-20 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618089803 NA 2.76E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618089803 1.95E-07 NA mr1536 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618089803 1.03E-08 1.03E-08 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618089803 NA 2.90E-11 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618089803 NA 5.02E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618089803 4.55E-06 NA mr1971 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618089803 4.73E-12 3.12E-106 mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618089803 NA 1.37E-19 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618089803 NA 4.88E-62 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618089803 1.03E-08 NA mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618089803 1.59E-06 NA mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251