Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618064174:

Variant ID: vg0618064174 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18064174
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGTGGTCCTTAACTCCAAGGCGAAGCCCCCGGACCAGGCTGATTCGACGGCAACCAATTGGGTGCACCTTGACTCGTGTTCCTCTCCGGCTGGGCCGA[G/A]
GGGGCTGTTCCTGAAATGCTGTGGGGTTGGCTGAGATGCTGAAGGAAAGCTTGAAGCTGTGCCTGCAAGGCCGAAGCCCCTTCTGCCATTGCTTGTGACA

Reverse complement sequence

TGTCACAAGCAATGGCAGAAGGGGCTTCGGCCTTGCAGGCACAGCTTCAAGCTTTCCTTCAGCATCTCAGCCAACCCCACAGCATTTCAGGAACAGCCCC[C/T]
TCGGCCCAGCCGGAGAGGAACACGAGTCAAGGTGCACCCAATTGGTTGCCGTCGAATCAGCCTGGTCCGGGGGCTTCGCCTTGGAGTTAAGGACCACAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.30% 10.60% 0.89% 12.21% NA
All Indica  2759 96.00% 1.80% 0.69% 1.49% NA
All Japonica  1512 35.40% 28.40% 1.06% 35.19% NA
Aus  269 98.50% 0.00% 1.49% 0.00% NA
Indica I  595 96.30% 1.30% 1.34% 1.01% NA
Indica II  465 94.60% 3.20% 0.86% 1.29% NA
Indica III  913 98.80% 0.30% 0.22% 0.66% NA
Indica Intermediate  786 93.40% 3.10% 0.64% 2.93% NA
Temperate Japonica  767 39.20% 20.60% 1.17% 38.98% NA
Tropical Japonica  504 19.20% 44.60% 0.99% 35.12% NA
Japonica Intermediate  241 56.80% 19.10% 0.83% 23.24% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 67.80% 24.40% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618064174 G -> A LOC_Os06g31040.1 upstream_gene_variant ; 3913.0bp to feature; MODIFIER silent_mutation Average:82.636; most accessible tissue: Zhenshan97 young leaf, score: 94.617 N N N N
vg0618064174 G -> A LOC_Os06g31060.1 downstream_gene_variant ; 1724.0bp to feature; MODIFIER silent_mutation Average:82.636; most accessible tissue: Zhenshan97 young leaf, score: 94.617 N N N N
vg0618064174 G -> A LOC_Os06g31060.2 downstream_gene_variant ; 1724.0bp to feature; MODIFIER silent_mutation Average:82.636; most accessible tissue: Zhenshan97 young leaf, score: 94.617 N N N N
vg0618064174 G -> A LOC_Os06g31050.1 intron_variant ; MODIFIER silent_mutation Average:82.636; most accessible tissue: Zhenshan97 young leaf, score: 94.617 N N N N
vg0618064174 G -> DEL N N silent_mutation Average:82.636; most accessible tissue: Zhenshan97 young leaf, score: 94.617 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0618064174 G A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618064174 NA 3.67E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618064174 4.08E-06 NA mr1140 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618064174 NA 5.76E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618064174 NA 9.19E-06 mr1269 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618064174 NA 8.03E-10 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618064174 NA 4.40E-21 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618064174 NA 9.31E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618064174 1.16E-08 NA mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618064174 NA 8.19E-10 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251