Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0618030192:

Variant ID: vg0618030192 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 18030192
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCTAGGTAAAGTAGCAGTTCGCTTCTCGGTGCTGGGCTGATCAAAGCTGGTGGGCTTTGCAGATATTACTTCAGTTCGTCGAACACTGCTTGGCATTC[A/G]
GGTGTCCAGGTAAACTTTCCCGCGCCCCGGAGGGTCTTGAAGAAGGGCAAGCCTCTTTTGGCTGCCTTTGAGAGGAATCGATTGAGTGCCGCAATTCTGC

Reverse complement sequence

GCAGAATTGCGGCACTCAATCGATTCCTCTCAAAGGCAGCCAAAAGAGGCTTGCCCTTCTTCAAGACCCTCCGGGGCGCGGGAAAGTTTACCTGGACACC[T/C]
GAATGCCAAGCAGTGTTCGACGAACTGAAGTAATATCTGCAAAGCCCACCAGCTTTGATCAGCCCAGCACCGAGAAGCGAACTGCTACTTTACCTAGCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.30% 23.50% 0.21% 0.00% NA
All Indica  2759 96.20% 3.70% 0.04% 0.00% NA
All Japonica  1512 34.50% 64.90% 0.60% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.60% 3.20% 0.17% 0.00% NA
Indica II  465 94.80% 5.20% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 94.00% 6.00% 0.00% 0.00% NA
Temperate Japonica  767 38.50% 61.10% 0.39% 0.00% NA
Tropical Japonica  504 19.20% 80.40% 0.40% 0.00% NA
Japonica Intermediate  241 53.90% 44.40% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0618030192 A -> G LOC_Os06g30990.1 synonymous_variant ; p.Pro183Pro; LOW synonymous_codon Average:77.189; most accessible tissue: Minghui63 flag leaf, score: 90.673 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0618030192 A G -0.01 0.0 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0618030192 8.17E-07 NA mr1087 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618030192 NA 2.42E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618030192 NA 1.46E-18 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618030192 NA 2.56E-20 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618030192 NA 6.20E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618030192 NA 3.06E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0618030192 NA 1.14E-11 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251