\
| Variant ID: vg0618007086 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 18007086 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 245. )
CAACTCTTTTTATTTAAAACATCTTACTTTTATAGATATTGTTTGTCAAAGTAGCATCTCGGAGACCGTGTCAGACTCTAAAAATGCTTATATTTTGGAA[T/C]
GAAGGGAGTAAATAATTCATAGATGCACGCTCACTCAAAATCATTCTTTCTAGGGGGAGACCTGTTCTGTGTCATCTCTTGGGAAGCATTAATGTTCTAT
ATAGAACATTAATGCTTCCCAAGAGATGACACAGAACAGGTCTCCCCCTAGAAAGAATGATTTTGAGTGAGCGTGCATCTATGAATTATTTACTCCCTTC[A/G]
TTCCAAAATATAAGCATTTTTAGAGTCTGACACGGTCTCCGAGATGCTACTTTGACAAACAATATCTATAAAAGTAAGATGTTTTAAATAAAAAGAGTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.50% | 19.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 44.10% | 55.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 54.50% | 45.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 19.60% | 80.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 62.20% | 37.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 26.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0618007086 | T -> C | LOC_Os06g30950.1 | intron_variant ; MODIFIER | silent_mutation | Average:42.985; most accessible tissue: Minghui63 flower, score: 51.629 | N | N | N | N |
| vg0618007086 | T -> C | LOC_Os06g30950.2 | intron_variant ; MODIFIER | silent_mutation | Average:42.985; most accessible tissue: Minghui63 flower, score: 51.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0618007086 | NA | 6.48E-06 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618007086 | NA | 9.70E-06 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618007086 | NA | 2.15E-07 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618007086 | NA | 6.79E-21 | mr1518 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618007086 | NA | 2.57E-06 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618007086 | NA | 1.01E-25 | mr1676 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618007086 | NA | 3.73E-08 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618007086 | 2.83E-06 | 5.98E-09 | mr1707 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618007086 | NA | 1.41E-06 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618007086 | NA | 5.23E-09 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0618007086 | NA | 9.20E-06 | mr1707_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |