Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617997472:

Variant ID: vg0617997472 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 17997472
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.22, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

AGTTAGGAGTTATAATAAACTATATATGTATATAAGATGTTATAAAAAAAGATGAAGAGACATTTAAATATTATATGAATTATGTGTGATGATGATATAA[T/C]
ATGCTTGCATTTGAAAAGCTATAAAATTTAATAAATTATAAAATTATAGATAATATAAGCATGATGTTTATATGTAATAGAGTAAATAAAGAACAAAAAA

Reverse complement sequence

TTTTTTGTTCTTTATTTACTCTATTACATATAAACATCATGCTTATATTATCTATAATTTTATAATTTATTAAATTTTATAGCTTTTCAAATGCAAGCAT[A/G]
TTATATCATCATCACACATAATTCATATAATATTTAAATGTCTCTTCATCTTTTTTTATAACATCTTATATACATATATAGTTTATTATAACTCCTAACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.60%	26.80%	0.25%	0.36%	NA
All Indica	2759	86.60%	13.30%	0.00%	0.07%	NA
All Japonica	1512	42.10%	56.30%	0.66%	0.99%	NA
Aus	269	92.60%	7.40%	0.00%	0.00%	NA
Indica I	595	86.60%	13.30%	0.00%	0.17%	NA
Indica II	465	94.80%	4.90%	0.00%	0.22%	NA
Indica III	913	83.50%	16.50%	0.00%	0.00%	NA
Indica Intermediate	786	85.50%	14.50%	0.00%	0.00%	NA
Temperate Japonica	767	52.00%	45.40%	1.17%	1.43%	NA
Tropical Japonica	504	18.50%	81.50%	0.00%	0.00%	NA
Japonica Intermediate	241	59.80%	38.20%	0.41%	1.66%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	70.00%	27.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0617997472	T -> C	LOC_Os06g30940.1	upstream_gene_variant ; 229.0bp to feature; MODIFIER	silent_mutation	Average:92.681; most accessible tissue: Callus, score: 96.912	N	N	N	N
vg0617997472	T -> C	LOC_Os06g30930.1	downstream_gene_variant ; 2058.0bp to feature; MODIFIER	silent_mutation	Average:92.681; most accessible tissue: Callus, score: 96.912	N	N	N	N
vg0617997472	T -> C	LOC_Os06g30930-LOC_Os06g30940	intergenic_region ; MODIFIER	silent_mutation	Average:92.681; most accessible tissue: Callus, score: 96.912	N	N	N	N
vg0617997472	T -> DEL	N	N	silent_mutation	Average:92.681; most accessible tissue: Callus, score: 96.912	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0617997472	NA	6.48E-06	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617997472	NA	9.70E-06	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617997472	NA	5.12E-09	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617997472	NA	2.57E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617997472	NA	5.68E-21	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617997472	NA	3.73E-08	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617997472	3.99E-06	NA	mr1707	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617997472	2.83E-06	5.98E-09	mr1707	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617997472	NA	5.98E-07	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617997472	NA	3.59E-07	mr1251_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617997472	NA	1.96E-07	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617997472	NA	7.53E-07	mr1291_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617997472	NA	3.76E-11	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617997472	NA	5.65E-07	mr1435_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617997472	NA	9.50E-06	mr1543_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617997472	NA	9.20E-06	mr1707_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251