Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617996660:

Variant ID: vg0617996660 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 17996660
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.05, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

AAACCAATCAATATTCCATCTGACCTTGATTTCTTTTACTCCTTGATTTAGCTGCTTGACTTCTACCATTTTCCCCTTAAAAAAATCAAGTGAGCTTAGA[G/A]
CAAATCACTGTATTGAGCTTGCAAGCGACACTGCGACAGCTACAACAACCAGCTATCACCAGGCTTGATTTTGCTGGTTCCTCAAGCTCAGGAACAGAGC

Reverse complement sequence

GCTCTGTTCCTGAGCTTGAGGAACCAGCAAAATCAAGCCTGGTGATAGCTGGTTGTTGTAGCTGTCGCAGTGTCGCTTGCAAGCTCAATACAGTGATTTG[C/T]
TCTAAGCTCACTTGATTTTTTTAAGGGGAAAATGGTAGAAGTCAAGCAGCTAAATCAAGGAGTAAAAGAAATCAAGGTCAGATGGAATATTGATTGGTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.10%	26.80%	0.08%	0.00%	NA
All Indica	2759	86.60%	13.30%	0.11%	0.00%	NA
All Japonica	1512	43.70%	56.30%	0.07%	0.00%	NA
Aus	269	92.60%	7.40%	0.00%	0.00%	NA
Indica I	595	86.90%	13.10%	0.00%	0.00%	NA
Indica II	465	94.60%	5.40%	0.00%	0.00%	NA
Indica III	913	83.40%	16.40%	0.22%	0.00%	NA
Indica Intermediate	786	85.50%	14.40%	0.13%	0.00%	NA
Temperate Japonica	767	54.40%	45.50%	0.13%	0.00%	NA
Tropical Japonica	504	18.70%	81.30%	0.00%	0.00%	NA
Japonica Intermediate	241	61.80%	38.20%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	70.00%	30.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0617996660	G -> A	LOC_Os06g30940.1	upstream_gene_variant ; 1041.0bp to feature; MODIFIER	silent_mutation	Average:68.418; most accessible tissue: Zhenshan97 root, score: 83.907	N	N	N	N
vg0617996660	G -> A	LOC_Os06g30930.1	downstream_gene_variant ; 1246.0bp to feature; MODIFIER	silent_mutation	Average:68.418; most accessible tissue: Zhenshan97 root, score: 83.907	N	N	N	N
vg0617996660	G -> A	LOC_Os06g30930-LOC_Os06g30940	intergenic_region ; MODIFIER	silent_mutation	Average:68.418; most accessible tissue: Zhenshan97 root, score: 83.907	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0617996660	NA	6.48E-06	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617996660	NA	9.70E-06	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617996660	NA	6.29E-10	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617996660	NA	2.57E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617996660	NA	7.34E-23	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617996660	NA	3.73E-08	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617996660	4.66E-06	NA	mr1707	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617996660	2.83E-06	5.98E-09	mr1707	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617996660	NA	1.24E-06	mr1291_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617996660	NA	4.35E-11	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617996660	NA	9.20E-06	mr1707_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251