Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617995261:

Variant ID: vg0617995261 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17995261
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


GGATGAGGAAATCATCATTGTTTGATGTATAGATAAGTTTTGTTCTGTTCACATTTCTTGAAAGTTTTGTTAGGACACTAATCATTTCACTCCCTTGGAT[T/G]
GGCTGGTCTACAGCATATCTTTGATAGGAAGTTGTACCACATGAGTTGTAAATGGTTTTAGATTGGCAATAGATGAACTGGCAGGGCTTGTAAGCTTGTT

Reverse complement sequence

AACAAGCTTACAAGCCCTGCCAGTTCATCTATTGCCAATCTAAAACCATTTACAACTCATGTGGTACAACTTCCTATCAAAGATATGCTGTAGACCAGCC[A/C]
ATCCAAGGGAGTGAAATGATTAGTGTCCTAACAAAACTTTCAAGAAATGTGAACAGAACAAAACTTATCTATACATCAAACAATGATGATTTCCTCATCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.60% 19.30% 0.08% 0.02% NA
All Indica  2759 98.10% 1.80% 0.07% 0.00% NA
All Japonica  1512 44.40% 55.40% 0.13% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 99.10% 0.70% 0.22% 0.00% NA
Indica Intermediate  786 96.40% 3.60% 0.00% 0.00% NA
Temperate Japonica  767 54.60% 45.20% 0.13% 0.00% NA
Tropical Japonica  504 20.20% 79.60% 0.00% 0.20% NA
Japonica Intermediate  241 62.20% 37.30% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617995261 T -> G LOC_Os06g30930.1 3_prime_UTR_variant ; 95.0bp to feature; MODIFIER silent_mutation Average:76.285; most accessible tissue: Minghui63 flag leaf, score: 88.574 N N N N
vg0617995261 T -> G LOC_Os06g30940.1 upstream_gene_variant ; 2440.0bp to feature; MODIFIER silent_mutation Average:76.285; most accessible tissue: Minghui63 flag leaf, score: 88.574 N N N N
vg0617995261 T -> DEL N N silent_mutation Average:76.285; most accessible tissue: Minghui63 flag leaf, score: 88.574 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0617995261 T G 0.01 -0.01 -0.03 0.02 0.0 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617995261 NA 3.85E-19 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617995261 NA 1.28E-23 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617995261 NA 4.69E-08 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617995261 2.48E-06 6.13E-09 mr1707 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617995261 NA 6.77E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617995261 NA 5.46E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617995261 9.70E-06 NA mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617995261 NA 5.84E-06 mr1707_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251