Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617992086:

Variant ID: vg0617992086 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 17992086
Reference Allele: A	Alternative Allele: C,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGGTGTAAAATTTTGGCGTGTCACATCGGATATTATATAGGGTGTCGCATGGGGTGTTCGGACACTAATAAAAAACTAATTACAGAATCCGTCAGTAAA[A/C,T]
CACGAGATAAATTTATTAAGCTTAATTAATCCGTCATTAGCAAATATTTACTGTAGCACCGAATTGTCAAATTATGGAGCAATTAGGTTTAAAAAATTCG

Reverse complement sequence

CGAATTTTTTAAACCTAATTGCTCCATAATTTGACAATTCGGTGCTACAGTAAATATTTGCTAATGACGGATTAATTAAGCTTAATAAATTTATCTCGTG[T/G,A]
TTTACTGACGGATTCTGTAATTAGTTTTTTATTAGTGTCCGAACACCCCATGCGACACCCTATATAATATCCGATGTGACACGCCAAAATTTTACACCCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.30%	8.00%	2.62%	0.93%	T: 0.06%
All Indica	2759	97.40%	0.10%	1.34%	1.09%	T: 0.11%
All Japonica	1512	73.10%	24.50%	2.38%	0.07%	NA
Aus	269	78.10%	0.00%	17.47%	4.46%	NA
Indica I	595	97.50%	0.00%	2.02%	0.50%	NA
Indica II	465	98.10%	0.20%	1.29%	0.43%	NA
Indica III	913	96.40%	0.00%	1.20%	2.08%	T: 0.33%
Indica Intermediate	786	98.10%	0.10%	1.02%	0.76%	NA
Temperate Japonica	767	57.90%	40.20%	1.96%	0.00%	NA
Tropical Japonica	504	92.90%	3.80%	3.17%	0.20%	NA
Japonica Intermediate	241	80.10%	17.80%	2.07%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	86.70%	8.90%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0617992086	A -> C	LOC_Os06g30930.1	upstream_gene_variant ; 913.0bp to feature; MODIFIER	silent_mutation	Average:43.506; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0617992086	A -> C	LOC_Os06g30920-LOC_Os06g30930	intergenic_region ; MODIFIER	silent_mutation	Average:43.506; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0617992086	A -> T	LOC_Os06g30930.1	upstream_gene_variant ; 913.0bp to feature; MODIFIER	silent_mutation	Average:43.506; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0617992086	A -> T	LOC_Os06g30920-LOC_Os06g30930	intergenic_region ; MODIFIER	silent_mutation	Average:43.506; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0617992086	A -> DEL	N	N	silent_mutation	Average:43.506; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0617992086	NA	3.86E-10	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	NA	4.22E-08	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	NA	2.17E-07	mr1149	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	6.46E-06	5.18E-14	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	NA	2.58E-06	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	NA	2.81E-06	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	NA	2.29E-11	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	2.68E-06	NA	mr1330	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	4.83E-06	2.68E-09	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	4.15E-06	2.04E-13	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	NA	7.86E-06	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	NA	9.22E-10	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	NA	4.00E-06	mr1707	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	2.70E-06	3.88E-10	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	NA	4.04E-08	mr1748	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	NA	5.48E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	NA	1.21E-07	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	NA	1.50E-09	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	NA	7.91E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	NA	7.38E-14	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	NA	2.64E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	NA	7.21E-11	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	NA	3.44E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086	NA	6.37E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251