\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617992086:

Variant ID: vg0617992086 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17992086
Reference Allele: AAlternative Allele: C,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGGTGTAAAATTTTGGCGTGTCACATCGGATATTATATAGGGTGTCGCATGGGGTGTTCGGACACTAATAAAAAACTAATTACAGAATCCGTCAGTAAA[A/C,T]
CACGAGATAAATTTATTAAGCTTAATTAATCCGTCATTAGCAAATATTTACTGTAGCACCGAATTGTCAAATTATGGAGCAATTAGGTTTAAAAAATTCG

Reverse complement sequence

CGAATTTTTTAAACCTAATTGCTCCATAATTTGACAATTCGGTGCTACAGTAAATATTTGCTAATGACGGATTAATTAAGCTTAATAAATTTATCTCGTG[T/G,A]
TTTACTGACGGATTCTGTAATTAGTTTTTTATTAGTGTCCGAACACCCCATGCGACACCCTATATAATATCCGATGTGACACGCCAAAATTTTACACCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.30% 8.00% 2.62% 0.93% T: 0.06%
All Indica  2759 97.40% 0.10% 1.34% 1.09% T: 0.11%
All Japonica  1512 73.10% 24.50% 2.38% 0.07% NA
Aus  269 78.10% 0.00% 17.47% 4.46% NA
Indica I  595 97.50% 0.00% 2.02% 0.50% NA
Indica II  465 98.10% 0.20% 1.29% 0.43% NA
Indica III  913 96.40% 0.00% 1.20% 2.08% T: 0.33%
Indica Intermediate  786 98.10% 0.10% 1.02% 0.76% NA
Temperate Japonica  767 57.90% 40.20% 1.96% 0.00% NA
Tropical Japonica  504 92.90% 3.80% 3.17% 0.20% NA
Japonica Intermediate  241 80.10% 17.80% 2.07% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 86.70% 8.90% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617992086 A -> C LOC_Os06g30930.1 upstream_gene_variant ; 913.0bp to feature; MODIFIER silent_mutation Average:43.506; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0617992086 A -> C LOC_Os06g30920-LOC_Os06g30930 intergenic_region ; MODIFIER silent_mutation Average:43.506; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0617992086 A -> T LOC_Os06g30930.1 upstream_gene_variant ; 913.0bp to feature; MODIFIER silent_mutation Average:43.506; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0617992086 A -> T LOC_Os06g30920-LOC_Os06g30930 intergenic_region ; MODIFIER silent_mutation Average:43.506; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0617992086 A -> DEL N N silent_mutation Average:43.506; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617992086 NA 3.86E-10 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 NA 4.22E-08 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 NA 2.17E-07 mr1149 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 6.46E-06 5.18E-14 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 NA 2.58E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 NA 2.81E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 NA 2.29E-11 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 2.68E-06 NA mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 4.83E-06 2.68E-09 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 4.15E-06 2.04E-13 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 NA 7.86E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 NA 9.22E-10 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 NA 4.00E-06 mr1707 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 2.70E-06 3.88E-10 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 NA 4.04E-08 mr1748 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 NA 5.48E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 NA 1.21E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 NA 1.50E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 NA 7.91E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 NA 7.38E-14 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 NA 2.64E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 NA 7.21E-11 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 NA 3.44E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617992086 NA 6.37E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251