\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617980791:

Variant ID: vg0617980791 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17980791
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


GTCTACATGGGTATCTATAGCTCTCTAATCCATTGCCTCGTTTTTCTCTATAGACTATCTCCAGGTTAGTAGATAGCTTTGCTCTCTCTCTTCATTTAAT[C/A]
TCTTTCAAGTAGGAAAATATGGTGACATGGATCTCTTGTAGAGAGCTTATAGATAACCATTGCGGGTGCCGTTAGCATCTATATGAATGTGATTAATGCT

Reverse complement sequence

AGCATTAATCACATTCATATAGATGCTAACGGCACCCGCAATGGTTATCTATAAGCTCTCTACAAGAGATCCATGTCACCATATTTTCCTACTTGAAAGA[G/T]
ATTAAATGAAGAGAGAGAGCAAAGCTATCTACTAACCTGGAGATAGTCTATAGAGAAAAACGAGGCAATGGATTAGAGAGCTATAGATACCCATGTAGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 9.00% 0.06% 0.00% NA
All Indica  2759 98.70% 1.20% 0.07% 0.00% NA
All Japonica  1512 74.70% 25.30% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 99.20% 0.50% 0.22% 0.00% NA
Indica Intermediate  786 98.00% 2.00% 0.00% 0.00% NA
Temperate Japonica  767 98.00% 2.00% 0.00% 0.00% NA
Tropical Japonica  504 36.90% 63.10% 0.00% 0.00% NA
Japonica Intermediate  241 79.30% 20.30% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617980791 C -> A LOC_Os06g30920.1 upstream_gene_variant ; 3662.0bp to feature; MODIFIER silent_mutation Average:73.521; most accessible tissue: Zhenshan97 flower, score: 86.268 N N N N
vg0617980791 C -> A LOC_Os06g30910.1 downstream_gene_variant ; 2101.0bp to feature; MODIFIER silent_mutation Average:73.521; most accessible tissue: Zhenshan97 flower, score: 86.268 N N N N
vg0617980791 C -> A LOC_Os06g30910-LOC_Os06g30920 intergenic_region ; MODIFIER silent_mutation Average:73.521; most accessible tissue: Zhenshan97 flower, score: 86.268 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0617980791 C A 0.06 0.04 0.02 0.02 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617980791 5.22E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617980791 5.66E-07 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617980791 NA 1.37E-24 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617980791 NA 1.11E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617980791 NA 2.31E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617980791 2.56E-07 NA mr1560 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617980791 NA 1.11E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617980791 NA 3.09E-07 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617980791 NA 4.80E-09 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617980791 5.37E-06 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617980791 2.00E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617980791 NA 7.56E-24 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617980791 NA 9.45E-11 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617980791 NA 7.14E-11 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251