Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617926432:

Variant ID: vg0617926432 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 17926432
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

GGTCACGCTCGCGGCCTGATCTAGCGGGGAGAGAGAGAGGGAACTAGAAACGATTTTTCCGTTGGAAGTTTTCTCGTGGGTCCTACTTTTAGTTTTTTTT[A/T]
GAAAGCTAATTTACCCAATCTTGTGGTGGGATGAAAATTTTAACACCTTTAATATCTGTTTAGGATTCCTATAACCAAAATTTTTAAGATATAATTTTGG

Reverse complement sequence

CCAAAATTATATCTTAAAAATTTTGGTTATAGGAATCCTAAACAGATATTAAAGGTGTTAAAATTTTCATCCCACCACAAGATTGGGTAAATTAGCTTTC[T/A]
AAAAAAAACTAAAAGTAGGACCCACGAGAAAACTTCCAACGGAAAAATCGTTTCTAGTTCCCTCTCTCTCTCCCCGCTAGATCAGGCCGCGAGCGTGACC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.70%	5.50%	1.82%	0.00%	NA
All Indica	2759	88.30%	8.70%	2.97%	0.00%	NA
All Japonica	1512	99.10%	0.80%	0.07%	0.00%	NA
Aus	269	99.30%	0.00%	0.74%	0.00%	NA
Indica I	595	95.10%	0.20%	4.71%	0.00%	NA
Indica II	465	84.50%	11.40%	4.09%	0.00%	NA
Indica III	913	83.80%	14.90%	1.31%	0.00%	NA
Indica Intermediate	786	90.70%	6.40%	2.93%	0.00%	NA
Temperate Japonica	767	98.70%	1.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	8.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0617926432	A -> T	LOC_Os06g30870.1	downstream_gene_variant ; 225.0bp to feature; MODIFIER	silent_mutation	Average:46.525; most accessible tissue: Zhenshan97 flower, score: 74.708	N	N	N	N
vg0617926432	A -> T	LOC_Os06g30860-LOC_Os06g30870	intergenic_region ; MODIFIER	silent_mutation	Average:46.525; most accessible tissue: Zhenshan97 flower, score: 74.708	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0617926432	3.77E-06	NA	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617926432	NA	6.49E-08	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617926432	7.62E-07	1.22E-09	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617926432	NA	8.34E-06	mr1122	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617926432	5.68E-06	3.31E-09	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617926432	2.87E-07	NA	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617926432	4.23E-08	1.19E-08	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617926432	7.74E-08	1.67E-09	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617926432	3.41E-07	NA	mr1200_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617926432	6.88E-08	3.76E-10	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251