\
| Variant ID: vg0617909927 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 17909927 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GGGACCAAGCACTGTGCGCCGATGGAGGCCGAGGAGTCGTGTGCCACTGCTGGCAGAGACTGAGGGACCAAGCGTTGCGCGTTGACGAAGGCCAAGGAGT[T/C]
GCATGCCGCCGCCAGTGAAGACGGAGGCTGAGGAGGAGTTGCGGCCGCCACGCGTGCGTTTGGTGGAGGCCGAGGATCAGGAGCCACGCGTCGTGTGCCG
CGGCACACGACGCGTGGCTCCTGATCCTCGGCCTCCACCAAACGCACGCGTGGCGGCCGCAACTCCTCCTCAGCCTCCGTCTTCACTGGCGGCGGCATGC[A/G]
ACTCCTTGGCCTTCGTCAACGCGCAACGCTTGGTCCCTCAGTCTCTGCCAGCAGTGGCACACGACTCCTCGGCCTCCATCGGCGCACAGTGCTTGGTCCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.10% | 2.10% | 0.83% | 0.00% | NA |
| All Indica | 2759 | 99.40% | 0.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 92.50% | 5.20% | 2.31% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 97.00% | 0.10% | 2.87% | 0.00% | NA |
| Tropical Japonica | 504 | 84.90% | 13.90% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 2.90% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 3.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617909927 | T -> C | LOC_Os06g30850.1 | synonymous_variant ; p.Ala153Ala; LOW | synonymous_codon | Average:74.744; most accessible tissue: Zhenshan97 young leaf, score: 89.875 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617909927 | 2.17E-06 | 1.54E-07 | mr1068_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617909927 | NA | 3.46E-06 | mr1078_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617909927 | NA | 1.79E-06 | mr1091_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617909927 | 5.56E-06 | 2.87E-08 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617909927 | NA | 1.24E-06 | mr1110_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617909927 | NA | 4.72E-06 | mr1112_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617909927 | NA | 2.06E-07 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617909927 | NA | 9.04E-07 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617909927 | 7.34E-06 | 7.33E-06 | mr1234_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617909927 | NA | 3.73E-06 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |