\
| Variant ID: vg0617895267 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 17895267 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 327. )
GGAATAGATTAAATCATTATATGTCTATAATCTCAACAATCCAAATCCCTTATTGTAGGCATTGTGATTTTACTATGGCTGGTTTTGCCGATGCACTGAG[G/A,T]
CCGGATAAATTCACCGGTGTGCATTTTAAGAGATGGCAGATCAGGGTCACTCTGTGGCTGACAGCTATGAAATGCTTCTGGGTGAGTACTGGCAAACCTG
CAGGTTTGCCAGTACTCACCCAGAAGCATTTCATAGCTGTCAGCCACAGAGTGACCCTGATCTGCCATCTCTTAAAATGCACACCGGTGAATTTATCCGG[C/T,A]
CTCAGTGCATCGGCAAAACCAGCCATAGTAAAATCACAATGCCTACAATAAGGGATTTGGATTGTTGAGATTATAGACATATAATGATTTAATCTATTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.80% | 7.00% | 0.15% | 0.00% | T: 0.02% |
| All Indica | 2759 | 88.80% | 11.00% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.70% | 12.10% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 84.60% | 15.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 88.40% | 11.10% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 0.00% | 0.00% | T: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617895267 | G -> T | LOC_Os06g30840.1 | missense_variant ; p.Arg9Ser; MODERATE | nonsynonymous_codon ; R9S | Average:27.285; most accessible tissue: Zhenshan97 flower, score: 31.8 | possibly damaging |
1.605 |
DELETERIOUS | 0.00 |
| vg0617895267 | G -> A | LOC_Os06g30840.1 | synonymous_variant ; p.Arg9Arg; LOW | synonymous_codon | Average:27.285; most accessible tissue: Zhenshan97 flower, score: 31.8 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617895267 | NA | 3.75E-06 | mr1014 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617895267 | NA | 9.85E-09 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617895267 | 4.25E-06 | 1.82E-09 | mr1043 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617895267 | NA | 3.69E-06 | mr1098 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617895267 | 9.06E-06 | 1.57E-07 | mr1291 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617895267 | NA | 4.07E-06 | mr1479 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617895267 | NA | 1.92E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617895267 | 7.20E-06 | 2.81E-08 | mr1912 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617895267 | NA | 2.33E-07 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617895267 | NA | 2.06E-06 | mr1043_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617895267 | NA | 5.46E-06 | mr1098_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617895267 | NA | 3.08E-07 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617895267 | NA | 2.34E-07 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617895267 | NA | 3.24E-06 | mr1291_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617895267 | NA | 4.20E-09 | mr1327_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |