\
| Variant ID: vg0617852939 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 17852939 |
| Reference Allele: A | Alternative Allele: T,G |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGCCTTTTCCTTTGCCTCACTACATCAACTGGTTCGCCGTTGACTAGTGAGTCGGGGGCTACAGATGTTATATCATATTTTTTAAACATTTTTTATAAT[A/T,G]
TTTATCTTGATTGCTTGCGATATAATCTGAGTACAAAAGTGCCTATCGAGTGATGGAGTTTCATCTTCCTATGCTTTCCGTTTGGTTTGCCAATGGATAG
CTATCCATTGGCAAACCAAACGGAAAGCATAGGAAGATGAAACTCCATCACTCGATAGGCACTTTTGTACTCAGATTATATCGCAAGCAATCAAGATAAA[T/A,C]
ATTATAAAAAATGTTTAAAAAATATGATATAACATCTGTAGCCCCCGACTCACTAGTCAACGGCGAACCAGTTGATGTAGTGAGGCAAAGGAAAAGGCAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 10.20% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 83.80% | 16.10% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.60% | 12.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 79.40% | 20.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 77.70% | 22.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617852939 | A -> G | LOC_Os06g30780-LOC_Os06g30790 | intergenic_region ; MODIFIER | N | Average:34.718; most accessible tissue: Zhenshan97 flower, score: 57.454 | N | N | N | N |
| vg0617852939 | A -> T | LOC_Os06g30780-LOC_Os06g30790 | intergenic_region ; MODIFIER | silent_mutation | Average:34.718; most accessible tissue: Zhenshan97 flower, score: 57.454 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617852939 | NA | 6.64E-16 | Plant_height | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0617852939 | NA | 3.43E-06 | mr1032 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852939 | NA | 3.76E-07 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852939 | NA | 4.06E-07 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852939 | NA | 8.34E-08 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852939 | NA | 5.31E-06 | mr1225 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852939 | NA | 9.72E-08 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852939 | NA | 3.11E-07 | mr1627 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852939 | NA | 5.55E-06 | mr1706 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852939 | NA | 1.29E-07 | mr1098_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852939 | NA | 1.41E-06 | mr1268_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852939 | NA | 3.32E-06 | mr1268_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852939 | NA | 3.29E-06 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852939 | NA | 1.07E-06 | mr1454_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852939 | NA | 1.79E-06 | mr1478_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852939 | NA | 8.28E-06 | mr1708_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852939 | 4.54E-06 | 1.36E-08 | mr1860_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852939 | NA | 4.57E-06 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852939 | NA | 5.08E-07 | mr1895_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852939 | NA | 4.46E-06 | mr1895_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852939 | NA | 3.78E-06 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |