| Variant ID: vg0617852766 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 17852766 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCCGCCGTTGTTGGGCGTCTACGACTTCACCGCCAACCGCCTAGGTTGCTTCCACGGCTGGTGTTTTCATCGCCATTGATGGACGACTTTGTTCCTAGAT[C/T]
GACTACTTCTGCTGTCACCGAGGGAATACGACAAAGCTAAGTCATCATTTATTTTATTCTTTATATGATATTTTGCCTTTTCCTTTGCCTCACTACATCA
TGATGTAGTGAGGCAAAGGAAAAGGCAAAATATCATATAAAGAATAAAATAAATGATGACTTAGCTTTGTCGTATTCCCTCGGTGACAGCAGAAGTAGTC[G/A]
ATCTAGGAACAAAGTCGTCCATCAATGGCGATGAAAACACCAGCCGTGGAAGCAACCTAGGCGGTTGGCGGTGAAGTCGTAGACGCCCAACAACGGCGGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.90% | 7.30% | 0.30% | 4.57% | NA |
| All Indica | 2759 | 91.00% | 1.00% | 0.33% | 7.61% | NA |
| All Japonica | 1512 | 79.40% | 20.30% | 0.26% | 0.07% | NA |
| Aus | 269 | 98.50% | 0.00% | 0.37% | 1.12% | NA |
| Indica I | 595 | 98.20% | 0.00% | 0.34% | 1.51% | NA |
| Indica II | 465 | 93.10% | 2.60% | 0.00% | 4.30% | NA |
| Indica III | 913 | 85.90% | 0.50% | 0.33% | 13.25% | NA |
| Indica Intermediate | 786 | 90.50% | 1.40% | 0.51% | 7.63% | NA |
| Temperate Japonica | 767 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 48.00% | 51.00% | 0.79% | 0.20% | NA |
| Japonica Intermediate | 241 | 84.20% | 15.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 8.90% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617852766 | C -> T | LOC_Os06g30780.1 | upstream_gene_variant ; 4894.0bp to feature; MODIFIER | silent_mutation | Average:54.07; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 | N | N | N | N |
| vg0617852766 | C -> T | LOC_Os06g30780-LOC_Os06g30790 | intergenic_region ; MODIFIER | silent_mutation | Average:54.07; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 | N | N | N | N |
| vg0617852766 | C -> DEL | N | N | silent_mutation | Average:54.07; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617852766 | NA | 8.65E-24 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852766 | NA | 2.83E-15 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852766 | NA | 1.28E-07 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852766 | 2.64E-09 | NA | mr1033_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852766 | NA | 2.76E-24 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852766 | NA | 1.78E-14 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617852766 | NA | 1.08E-10 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |