Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617852624:

Variant ID: vg0617852624 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 17852624
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTGCCTCCATTGCCGCCGACTGGTGCCTCCGCCTACACGGCTGGCCTGTTATGCCGTTGTTGTTAGGCGTCTACGACTTCACCGTCGGCCTGCCTCCGT[T/C]
GCCGCCGACTGGTGCCTCCGCCTACACGGCTGGCCTCTTATGCCGCCGTTGTTGGGCGTCTACGACTTCACCGCCAACCGCCTAGGTTGCTTCCACGGCT

Reverse complement sequence

AGCCGTGGAAGCAACCTAGGCGGTTGGCGGTGAAGTCGTAGACGCCCAACAACGGCGGCATAAGAGGCCAGCCGTGTAGGCGGAGGCACCAGTCGGCGGC[A/G]
ACGGAGGCAGGCCGACGGTGAAGTCGTAGACGCCTAACAACAACGGCATAACAGGCCAGCCGTGTAGGCGGAGGCACCAGTCGGCGGCAATGGAGGCAGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.80%	30.90%	4.19%	0.13%	NA
All Indica	2759	97.20%	2.30%	0.29%	0.22%	NA
All Japonica	1512	9.80%	89.90%	0.26%	0.00%	NA
Aus	269	62.80%	1.90%	35.32%	0.00%	NA
Indica I	595	97.80%	2.20%	0.00%	0.00%	NA
Indica II	465	96.80%	3.20%	0.00%	0.00%	NA
Indica III	913	98.60%	0.80%	0.44%	0.22%	NA
Indica Intermediate	786	95.30%	3.70%	0.51%	0.51%	NA
Temperate Japonica	767	3.70%	96.30%	0.00%	0.00%	NA
Tropical Japonica	504	20.20%	79.60%	0.20%	0.00%	NA
Japonica Intermediate	241	7.50%	91.30%	1.24%	0.00%	NA
VI/Aromatic	96	14.60%	2.10%	83.33%	0.00%	NA
Intermediate	90	54.40%	33.30%	12.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0617852624	T -> C	LOC_Os06g30780.1	upstream_gene_variant ; 4752.0bp to feature; MODIFIER	silent_mutation	Average:61.468; most accessible tissue: Zhenshan97 flower, score: 73.946	N	N	N	N
vg0617852624	T -> C	LOC_Os06g30780-LOC_Os06g30790	intergenic_region ; MODIFIER	silent_mutation	Average:61.468; most accessible tissue: Zhenshan97 flower, score: 73.946	N	N	N	N
vg0617852624	T -> DEL	N	N	silent_mutation	Average:61.468; most accessible tissue: Zhenshan97 flower, score: 73.946	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0617852624	NA	3.10E-56	mr1019	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852624	6.90E-15	2.81E-83	mr1033	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852624	9.41E-15	2.44E-20	mr1033	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852624	NA	5.81E-69	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852624	NA	9.10E-11	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852624	3.36E-08	2.12E-43	mr1176	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852624	6.70E-10	3.45E-13	mr1176	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852624	NA	1.30E-54	mr1178	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852624	NA	5.45E-27	mr1223	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852624	NA	1.07E-06	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852624	NA	7.00E-17	mr1276	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852624	NA	1.09E-20	mr1477	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852624	NA	2.65E-18	mr1529	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852624	3.12E-06	NA	mr1536	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852624	3.09E-09	3.09E-09	mr1536	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852624	4.47E-18	2.14E-118	mr1033_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852624	2.79E-18	1.03E-27	mr1033_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852624	NA	2.21E-19	mr1276_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852624	2.07E-07	NA	mr1536_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852624	1.53E-10	3.70E-12	mr1536_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617852624	NA	2.29E-14	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251