\
| Variant ID: vg0617850077 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 17850077 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CATACTTGTTTTTTCATTGCGATATATAGAGACGTTAAATTTTAAGTTGCATATTTATGAAGTTATATATTATATGTTAATACATCTTTTCAATTTTGTT[C/T]
ATAAGTATTTAAGTGACATGGAAACAACAATAGGATTTTCCCTCAAGAGTTTGAAATGCACTCTCCACGTAACATGTCACGTTAATCTATTTTTCTATTC
GAATAGAAAAATAGATTAACGTGACATGTTACGTGGAGAGTGCATTTCAAACTCTTGAGGGAAAATCCTATTGTTGTTTCCATGTCACTTAAATACTTAT[G/A]
AACAAAATTGAAAAGATGTATTAACATATAATATATAACTTCATAAATATGCAACTTAAAATTTAACGTCTCTATATATCGCAATGAAAAAACAAGTATG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.60% | 36.40% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 95.50% | 4.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 9.90% | 90.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 61.00% | 39.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.90% | 6.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 20.40% | 79.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.50% | 92.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 50.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617850077 | C -> T | LOC_Os06g30780.1 | upstream_gene_variant ; 2205.0bp to feature; MODIFIER | silent_mutation | Average:37.606; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0617850077 | C -> T | LOC_Os06g30770.1 | downstream_gene_variant ; 4011.0bp to feature; MODIFIER | silent_mutation | Average:37.606; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0617850077 | C -> T | LOC_Os06g30780-LOC_Os06g30790 | intergenic_region ; MODIFIER | silent_mutation | Average:37.606; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617850077 | 3.99E-12 | 2.88E-76 | mr1033 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | 2.51E-06 | 3.85E-12 | mr1033 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | 2.74E-11 | 3.17E-16 | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | NA | 9.15E-06 | mr1076 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | NA | 4.85E-07 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | NA | 4.50E-07 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | NA | 2.26E-06 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | NA | 4.85E-07 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | 7.74E-07 | 2.98E-41 | mr1176 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | NA | 7.64E-07 | mr1176 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | 8.60E-08 | 1.32E-10 | mr1176 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | NA | 4.72E-07 | mr1204 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | NA | 2.69E-09 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | NA | 3.46E-09 | mr1410 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | NA | 8.65E-07 | mr1436 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | NA | 2.84E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | 3.52E-08 | 3.52E-08 | mr1536 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | NA | 4.14E-06 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | NA | 3.50E-06 | mr1993 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | 6.65E-11 | NA | mr1033_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | NA | 3.68E-16 | mr1033_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | 1.67E-13 | 1.35E-21 | mr1033_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | 4.78E-09 | 1.09E-10 | mr1536_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | NA | 1.03E-07 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617850077 | NA | 2.16E-08 | mr1993_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |