\
| Variant ID: vg0617845062 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 17845062 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 119. )
GCGGGGATACGGTAATATAAATACCGCGGTAACCTCCTTAAATTTAAATAAATTTAAAAAATAATTTAAATTTTTGATAAATTTTGCACGGCTTTGTACG[G/T]
TTTTTCACAGTTACCACGGTTACCGTGCGGTAACCGTGCTTACCGCCGGGGCACGGTAACCCCGGTCCTGGTGGTTTTGGAAACCCTGACGGAAACCGAG
CTCGGTTTCCGTCAGGGTTTCCAAAACCACCAGGACCGGGGTTACCGTGCCCCGGCGGTAAGCACGGTTACCGCACGGTAACCGTGGTAACTGTGAAAAA[C/A]
CGTACAAAGCCGTGCAAAATTTATCAAAAATTTAAATTATTTTTTAAATTTATTTAAATTTAAGGAGGTTACCGCGGTATTTATATTACCGTATCCCCGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.40% | 44.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 30.10% | 69.90% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 97.70% | 2.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 63.90% | 36.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 21.20% | 78.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 11.80% | 88.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 37.00% | 63.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 39.60% | 60.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 0.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 38.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617845062 | G -> T | LOC_Os06g30770.1 | upstream_gene_variant ; 516.0bp to feature; MODIFIER | silent_mutation | Average:55.675; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg0617845062 | G -> T | LOC_Os06g30750.1 | downstream_gene_variant ; 4143.0bp to feature; MODIFIER | silent_mutation | Average:55.675; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg0617845062 | G -> T | LOC_Os06g30760.1 | downstream_gene_variant ; 865.0bp to feature; MODIFIER | silent_mutation | Average:55.675; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg0617845062 | G -> T | LOC_Os06g30780.1 | downstream_gene_variant ; 2241.0bp to feature; MODIFIER | silent_mutation | Average:55.675; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg0617845062 | G -> T | LOC_Os06g30750.2 | downstream_gene_variant ; 4143.0bp to feature; MODIFIER | silent_mutation | Average:55.675; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg0617845062 | G -> T | LOC_Os06g30760-LOC_Os06g30770 | intergenic_region ; MODIFIER | silent_mutation | Average:55.675; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617845062 | NA | 6.23E-10 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 1.83E-09 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 5.94E-07 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | 3.69E-06 | NA | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 1.33E-09 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | 5.29E-07 | 2.90E-39 | mr1091 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 6.65E-14 | mr1091 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | 6.34E-08 | 2.62E-36 | mr1094 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | 8.27E-07 | 2.26E-13 | mr1094 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 1.69E-10 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 1.79E-06 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | 8.21E-06 | NA | mr1108 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 1.09E-11 | mr1108 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | 2.18E-06 | 2.67E-39 | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 6.75E-11 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 1.32E-08 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | 7.44E-06 | NA | mr1112 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 2.82E-11 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 6.30E-07 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | 7.95E-07 | NA | mr1144 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 5.61E-10 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | 7.58E-07 | NA | mr1234 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 1.57E-12 | mr1234 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 3.46E-07 | mr1237 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 2.03E-06 | mr1526 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | 7.67E-06 | NA | mr1065_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 1.93E-15 | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 1.57E-12 | mr1067_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 8.06E-13 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 2.33E-09 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | 2.92E-06 | NA | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | 1.63E-06 | 5.40E-12 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 9.52E-07 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | 1.39E-06 | NA | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 4.53E-16 | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 1.63E-12 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 5.54E-12 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | 8.37E-06 | NA | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 2.15E-13 | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 1.64E-38 | mr1110_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 3.76E-11 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 1.29E-11 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | 2.01E-06 | NA | mr1112_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 1.01E-15 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 2.83E-10 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 3.84E-11 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 2.71E-07 | mr1155_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 1.38E-09 | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 7.04E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | 2.05E-06 | NA | mr1234_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | 7.26E-06 | 1.06E-14 | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 4.94E-08 | mr1244_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 7.93E-06 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617845062 | NA | 6.28E-15 | mr1454_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |