\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617829118:

Variant ID: vg0617829118 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17829118
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, C: 0.03, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


CGAAACGACGGTGTTGCCATGGCTACCATATGATGGCATCATGGGGTGTCGTGGAGCGGGGGCGAAGAGGAGAAAGCGTACCTGGAGCAATGTCAATGGA[A/C]
GAGAGCGATCAATGAAGGAGATTGGCCTGACCTAATTGATCCAAGACGCTAACGACAGGAAACTCTATGCTCGACCAGGTGACCTTGGATACTGCTAACT

Reverse complement sequence

AGTTAGCAGTATCCAAGGTCACCTGGTCGAGCATAGAGTTTCCTGTCGTTAGCGTCTTGGATCAATTAGGTCAGGCCAATCTCCTTCATTGATCGCTCTC[T/G]
TCCATTGACATTGCTCCAGGTACGCTTTCTCCTCTTCGCCCCCGCTCCACGACACCCCATGATGCCATCATATGGTAGCCATGGCAACACCGTCGTTTCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.80% 46.90% 0.13% 0.23% NA
All Indica  2759 25.70% 73.80% 0.18% 0.29% NA
All Japonica  1512 97.70% 2.20% 0.07% 0.07% NA
Aus  269 62.80% 37.20% 0.00% 0.00% NA
Indica I  595 20.80% 78.70% 0.17% 0.34% NA
Indica II  465 11.60% 87.70% 0.22% 0.43% NA
Indica III  913 32.00% 67.70% 0.22% 0.11% NA
Indica Intermediate  786 30.50% 69.00% 0.13% 0.38% NA
Temperate Japonica  767 96.60% 3.30% 0.00% 0.13% NA
Tropical Japonica  504 99.00% 0.80% 0.20% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 58.90% 38.90% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617829118 A -> C LOC_Os06g30730.1 upstream_gene_variant ; 4303.0bp to feature; MODIFIER silent_mutation Average:60.542; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0617829118 A -> C LOC_Os06g30740.1 downstream_gene_variant ; 3519.0bp to feature; MODIFIER silent_mutation Average:60.542; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0617829118 A -> C LOC_Os06g30730-LOC_Os06g30740 intergenic_region ; MODIFIER silent_mutation Average:60.542; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0617829118 A -> DEL N N silent_mutation Average:60.542; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617829118 2.12E-06 NA mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 6.43E-06 8.39E-09 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 2.97E-06 NA mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 NA 4.83E-10 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 NA 2.48E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 NA 3.25E-36 mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 NA 8.23E-08 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 NA 8.18E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 NA 1.44E-10 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 1.29E-06 NA mr1067_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 8.28E-06 1.95E-10 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 6.17E-06 3.80E-08 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 3.93E-08 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 6.67E-09 2.04E-12 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 6.53E-06 NA mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 3.48E-07 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 NA 3.07E-12 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 NA 3.76E-08 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 NA 9.33E-08 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 2.48E-07 NA mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 2.99E-06 1.31E-10 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 NA 1.05E-37 mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 NA 4.34E-09 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 5.01E-06 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 6.80E-07 4.80E-08 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 3.85E-07 NA mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 8.86E-07 2.38E-12 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 NA 1.50E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 NA 8.64E-07 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 8.30E-07 NA mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 4.21E-06 4.51E-11 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 NA 3.45E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 NA 3.88E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617829118 NA 1.43E-10 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251