Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617810167:

Variant ID: vg0617810167 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17810167
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCTAGCTTGCTTCTAGATGGAGTCAGATTCCATTCTAATTGGACTAACTTTGCAAACCCTCCAAGTGTCATCTTATCATTTGCTCTAAAAGTTTCAAT[G/A]
TACTTCTCAGATAGCCATTTAGCAGTACACCTTTCAGCACCCATTCCTTCTGACATTTATGCTCCCCAAGATATGTCTTCACCATCATTGACTTGGACCT

Reverse complement sequence

AGGTCCAAGTCAATGATGGTGAAGACATATCTTGGGGAGCATAAATGTCAGAAGGAATGGGTGCTGAAAGGTGTACTGCTAAATGGCTATCTGAGAAGTA[C/T]
ATTGAAACTTTTAGAGCAAATGATAAGATGACACTTGGAGGGTTTGCAAAGTTAGTCCAATTAGAATGGAATCTGACTCCATCTAGAAGCAAGCTAGCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.90% 42.90% 0.19% 0.00% NA
All Indica  2759 86.10% 13.70% 0.25% 0.00% NA
All Japonica  1512 8.70% 91.30% 0.00% 0.00% NA
Aus  269 49.40% 50.60% 0.00% 0.00% NA
Indica I  595 91.30% 8.40% 0.34% 0.00% NA
Indica II  465 89.90% 9.70% 0.43% 0.00% NA
Indica III  913 83.40% 16.60% 0.00% 0.00% NA
Indica Intermediate  786 83.10% 16.50% 0.38% 0.00% NA
Temperate Japonica  767 3.70% 96.30% 0.00% 0.00% NA
Tropical Japonica  504 16.90% 83.10% 0.00% 0.00% NA
Japonica Intermediate  241 7.50% 92.50% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 42.20% 55.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617810167 G -> A LOC_Os06g30710.1 upstream_gene_variant ; 1918.0bp to feature; MODIFIER silent_mutation Average:6.529; most accessible tissue: Zhenshan97 flag leaf, score: 11.736 N N N N
vg0617810167 G -> A LOC_Os06g30710.2 upstream_gene_variant ; 1891.0bp to feature; MODIFIER silent_mutation Average:6.529; most accessible tissue: Zhenshan97 flag leaf, score: 11.736 N N N N
vg0617810167 G -> A LOC_Os06g30710.3 upstream_gene_variant ; 1891.0bp to feature; MODIFIER silent_mutation Average:6.529; most accessible tissue: Zhenshan97 flag leaf, score: 11.736 N N N N
vg0617810167 G -> A LOC_Os06g30700.1 intron_variant ; MODIFIER silent_mutation Average:6.529; most accessible tissue: Zhenshan97 flag leaf, score: 11.736 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617810167 5.79E-09 3.92E-12 mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 2.29E-08 1.02E-49 mr1067 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 8.67E-07 4.55E-12 mr1067 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 3.24E-07 NA mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 8.34E-06 1.25E-10 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 6.71E-09 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 2.75E-39 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 5.49E-07 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 2.13E-06 1.40E-08 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 7.03E-06 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 1.88E-07 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 3.30E-11 2.01E-17 mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 2.50E-57 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 2.59E-14 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 6.07E-08 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 8.42E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 6.15E-06 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 9.92E-15 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 2.53E-08 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 1.11E-11 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 3.27E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 2.08E-08 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 3.08E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 1.32E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 1.01E-08 mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 3.15E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 1.32E-11 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 5.41E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 2.30E-06 NA mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 8.68E-08 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 8.41E-06 NA mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 4.39E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 6.70E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617810167 NA 9.46E-09 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251