\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617795766:

Variant ID: vg0617795766 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17795766
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


CAACGAAAAATTAGCCCTTCATCCAACTATATCTTACGTCCCATCACCCTTCAACCCCCAACAATCCCGAATTTAACGAGGGCTCAAAATCTTTTATCCT[C/T]
AATATTAATCTCTACTAAATAACCTATAAATACTTATATTGTTGGGAGTACAACCATTGCTTTTCTGATATCTCATATATATTTGCCCTAGTATTTTTTA

Reverse complement sequence

TAAAAAATACTAGGGCAAATATATATGAGATATCAGAAAAGCAATGGTTGTACTCCCAACAATATAAGTATTTATAGGTTATTTAGTAGAGATTAATATT[G/A]
AGGATAAAAGATTTTGAGCCCTCGTTAAATTCGGGATTGTTGGGGGTTGAAGGGTGATGGGACGTAAGATATAGTTGGATGAAGGGCTAATTTTTCGTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 5.20% 0.00% 0.00% NA
All Indica  2759 91.50% 8.50% 0.00% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.80% 2.20% 0.00% 0.00% NA
Indica II  465 95.10% 4.90% 0.00% 0.00% NA
Indica III  913 85.90% 14.10% 0.00% 0.00% NA
Indica Intermediate  786 91.10% 8.90% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617795766 C -> T LOC_Os06g30690.1 upstream_gene_variant ; 1650.0bp to feature; MODIFIER silent_mutation Average:52.515; most accessible tissue: Callus, score: 74.548 N N N N
vg0617795766 C -> T LOC_Os06g30700.1 downstream_gene_variant ; 1734.0bp to feature; MODIFIER silent_mutation Average:52.515; most accessible tissue: Callus, score: 74.548 N N N N
vg0617795766 C -> T LOC_Os06g30690-LOC_Os06g30700 intergenic_region ; MODIFIER silent_mutation Average:52.515; most accessible tissue: Callus, score: 74.548 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617795766 9.76E-06 2.85E-09 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617795766 6.53E-06 6.53E-06 mr1808 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617795766 NA 3.24E-08 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617795766 NA 2.28E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617795766 NA 6.35E-14 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617795766 NA 4.36E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251