\
| Variant ID: vg0617714131 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 17714131 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )
CTATACTATGCTAACCATTGCCACCAACATCATCATCATCAACGGGTTCTACTGCATGCACTTCTTCTTCTTCTTCTTCAGCTACTACAATGACATCCTC[G/A]
TCCCAGCTCAACACTTCGTCGTGTACTGTAGCCTGGTTCGGAACTTGCTTGCTTGGGATCTCTCCATGATGTGACCAGTTTGTGTATCCCTCAACAAATC
GATTTGTTGAGGGATACACAAACTGGTCACATCATGGAGAGATCCCAAGCAAGCAAGTTCCGAACCAGGCTACAGTACACGACGAAGTGTTGAGCTGGGA[C/T]
GAGGATGTCATTGTAGTAGCTGAAGAAGAAGAAGAAGAAGTGCATGCAGTAGAACCCGTTGATGATGATGATGTTGGTGGCAATGGTTAGCATAGTATAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.60% | 8.30% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 99.00% | 0.90% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 76.00% | 23.70% | 0.26% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.20% | 1.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 40.50% | 59.10% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.70% | 19.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617714131 | G -> A | LOC_Os06g30610.1 | synonymous_variant ; p.Asp99Asp; LOW | synonymous_codon | Average:21.829; most accessible tissue: Minghui63 young leaf, score: 33.985 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617714131 | NA | 2.11E-06 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617714131 | NA | 4.20E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617714131 | 1.55E-08 | NA | mr1484 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617714131 | NA | 9.55E-07 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617714131 | NA | 3.08E-08 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617714131 | NA | 2.07E-07 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617714131 | NA | 1.42E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617714131 | NA | 2.91E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617714131 | NA | 1.00E-06 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617714131 | NA | 5.54E-06 | mr1206_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617714131 | NA | 2.41E-11 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617714131 | NA | 4.16E-14 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |