\
| Variant ID: vg0617709303 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 17709303 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCACCGCTTCAATTTCACCCGCCGCTAGCTTTGTAGGCTCTGCTTGTACAGGCTCTGATGGTTCTTCTGCATCCTTTAATGTCTGAGGTGATGCAACGGG[A/T]
GGCTCCGGTACTGGAGGTGATGTAACTGGTGGCTCTGGTACTGGAGGTGATGCAACTGGTGGCTCTGGTCCTCGAGGTGATGCAACTGGTGGCTCTGGTC
GACCAGAGCCACCAGTTGCATCACCTCGAGGACCAGAGCCACCAGTTGCATCACCTCCAGTACCAGAGCCACCAGTTACATCACCTCCAGTACCGGAGCC[T/A]
CCCGTTGCATCACCTCAGACATTAAAGGATGCAGAAGAACCATCAGAGCCTGTACAAGCAGAGCCTACAAAGCTAGCGGCGGGTGAAATTGAAGCGGTGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.10% | 0.50% | 0.95% | 46.53% | NA |
| All Indica | 2759 | 24.90% | 0.00% | 1.09% | 74.01% | NA |
| All Japonica | 1512 | 96.20% | 1.30% | 0.60% | 1.92% | NA |
| Aus | 269 | 62.50% | 0.00% | 1.12% | 36.43% | NA |
| Indica I | 595 | 23.40% | 0.00% | 0.50% | 76.13% | NA |
| Indica II | 465 | 10.10% | 0.00% | 1.94% | 87.96% | NA |
| Indica III | 913 | 26.00% | 0.10% | 1.64% | 72.29% | NA |
| Indica Intermediate | 786 | 33.50% | 0.00% | 0.38% | 66.16% | NA |
| Temperate Japonica | 767 | 96.70% | 0.00% | 0.39% | 2.87% | NA |
| Tropical Japonica | 504 | 95.80% | 3.00% | 0.40% | 0.79% | NA |
| Japonica Intermediate | 241 | 95.40% | 1.70% | 1.66% | 1.24% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 2.20% | 3.33% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617709303 | A -> T | LOC_Os06g30610.1 | synonymous_variant ; p.Pro650Pro; LOW | synonymous_codon | Average:8.886; most accessible tissue: Callus, score: 16.543 | N | N | N | N |
| vg0617709303 | A -> DEL | LOC_Os06g30610.1 | N | frameshift_variant | Average:8.886; most accessible tissue: Callus, score: 16.543 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617709303 | NA | 3.32E-21 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617709303 | NA | 4.23E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617709303 | 3.77E-07 | 5.21E-21 | mr1518 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617709303 | NA | 5.33E-08 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617709303 | 5.71E-06 | 3.04E-21 | mr1676 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617709303 | NA | 9.78E-07 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617709303 | NA | 1.45E-06 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617709303 | NA | 8.41E-21 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617709303 | 1.05E-06 | NA | mr1676_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617709303 | NA | 2.41E-14 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617709303 | NA | 2.83E-10 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |