\
| Variant ID: vg0617705132 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 17705132 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACCCCTCACGGCTGTGGCTCTCAGGCGGTCACACAACCTGCCTAGGCCCAGTGCTGGGCCTTGACGCGATGGGCCAACAACAAGGTATTCAAGGTATGGG[C/T]
GAGGTTGCCAGGATTGCAACTGTGGTATGCACCAATCAAACAAAATAGTTGCGGAAAATTTGAGGCAGACCAACCAAATAACTAAAAAAAGCGAGAATGT
ACATTCTCGCTTTTTTTAGTTATTTGGTTGGTCTGCCTCAAATTTTCCGCAACTATTTTGTTTGATTGGTGCATACCACAGTTGCAATCCTGGCAACCTC[G/A]
CCCATACCTTGAATACCTTGTTGTTGGCCCATCGCGTCAAGGCCCAGCACTGGGCCTAGGCAGGTTGTGTGACCGCCTGAGAGCCACAGCCGTGAGGGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.40% | 8.40% | 0.47% | 1.76% | NA |
| All Indica | 2759 | 98.70% | 1.10% | 0.04% | 0.22% | NA |
| All Japonica | 1512 | 75.70% | 23.90% | 0.00% | 0.46% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.60% | 0.00% | 0.22% | NA |
| Indica III | 913 | 98.90% | 0.50% | 0.11% | 0.44% | NA |
| Indica Intermediate | 786 | 98.30% | 1.50% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 98.20% | 1.70% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 40.50% | 59.10% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 77.60% | 20.70% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 15.60% | 0.00% | 18.75% | 65.62% | NA |
| Intermediate | 90 | 80.00% | 8.90% | 3.33% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617705132 | C -> T | LOC_Os06g30600.1 | synonymous_variant ; p.Gly11Gly; LOW | synonymous_codon | Average:61.899; most accessible tissue: Callus, score: 94.341 | N | N | N | N |
| vg0617705132 | C -> DEL | LOC_Os06g30600.1 | N | frameshift_variant | Average:61.899; most accessible tissue: Callus, score: 94.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617705132 | 6.95E-06 | NA | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617705132 | 4.52E-07 | NA | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617705132 | 1.01E-08 | NA | mr1083 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617705132 | 2.01E-06 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617705132 | NA | 2.95E-07 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617705132 | NA | 1.51E-25 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617705132 | NA | 5.28E-09 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617705132 | NA | 8.53E-15 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617705132 | 2.40E-06 | NA | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617705132 | NA | 1.12E-06 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617705132 | NA | 4.20E-08 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617705132 | NA | 2.35E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617705132 | NA | 3.26E-09 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617705132 | NA | 9.31E-21 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617705132 | NA | 6.34E-13 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |