\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617703446:

Variant ID: vg0617703446 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17703446
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.10, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTCAGCGCTAAATAGCCTCTTGGGCTAAACCACTACACCAACTAAGCTTGAGTAAAACTCAAACTTAGCAACATGAACTGGCTTTGTCATCGTATCAG[C/T]
AGGATTATCATGACAGTGCTTATATTGTATACCTTTAGCTTACCTTGTGCGACTACATCGTGAATATAATGATACTTGATATCAATGTGATTTGTAACAT

Reverse complement sequence

ATGTTACAAATCACATTGATATCAAGTATCATTATATTCACGATGTAGTCGCACAAGGTAAGCTAAAGGTATACAATATAAGCACTGTCATGATAATCCT[G/A]
CTGATACGATGACAAAGCCAGTTCATGTTGCTAAGTTTGAGTTTTACTCAAGCTTAGTTGGTGTAGTGGTTTAGCCCAAGAGGCTATTTAGCGCTGAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.80% 49.70% 0.25% 0.23% NA
All Indica  2759 20.80% 78.50% 0.29% 0.40% NA
All Japonica  1512 97.60% 2.20% 0.20% 0.00% NA
Aus  269 58.00% 42.00% 0.00% 0.00% NA
Indica I  595 19.50% 80.00% 0.17% 0.34% NA
Indica II  465 5.80% 93.30% 0.43% 0.43% NA
Indica III  913 22.20% 77.00% 0.44% 0.33% NA
Indica Intermediate  786 29.00% 70.40% 0.13% 0.51% NA
Temperate Japonica  767 96.60% 3.40% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 0.80% 0.40% 0.00% NA
Japonica Intermediate  241 98.30% 1.20% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 55.60% 43.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617703446 C -> T LOC_Os06g30590.1 upstream_gene_variant ; 4135.0bp to feature; MODIFIER silent_mutation Average:47.296; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0617703446 C -> T LOC_Os06g30600.1 upstream_gene_variant ; 1654.0bp to feature; MODIFIER silent_mutation Average:47.296; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0617703446 C -> T LOC_Os06g30610.1 downstream_gene_variant ; 4126.0bp to feature; MODIFIER silent_mutation Average:47.296; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0617703446 C -> T LOC_Os06g30590-LOC_Os06g30600 intergenic_region ; MODIFIER silent_mutation Average:47.296; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0617703446 C -> DEL N N silent_mutation Average:47.296; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617703446 NA 6.26E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617703446 NA 2.31E-06 mr1354 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617703446 NA 5.30E-06 mr1134_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617703446 NA 1.69E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617703446 NA 5.76E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617703446 NA 8.33E-06 mr1462_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251