\
| Variant ID: vg0617703446 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 17703446 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.10, others allele: 0.00, population size: 277. )
CTTTCAGCGCTAAATAGCCTCTTGGGCTAAACCACTACACCAACTAAGCTTGAGTAAAACTCAAACTTAGCAACATGAACTGGCTTTGTCATCGTATCAG[C/T]
AGGATTATCATGACAGTGCTTATATTGTATACCTTTAGCTTACCTTGTGCGACTACATCGTGAATATAATGATACTTGATATCAATGTGATTTGTAACAT
ATGTTACAAATCACATTGATATCAAGTATCATTATATTCACGATGTAGTCGCACAAGGTAAGCTAAAGGTATACAATATAAGCACTGTCATGATAATCCT[G/A]
CTGATACGATGACAAAGCCAGTTCATGTTGCTAAGTTTGAGTTTTACTCAAGCTTAGTTGGTGTAGTGGTTTAGCCCAAGAGGCTATTTAGCGCTGAAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.80% | 49.70% | 0.25% | 0.23% | NA |
| All Indica | 2759 | 20.80% | 78.50% | 0.29% | 0.40% | NA |
| All Japonica | 1512 | 97.60% | 2.20% | 0.20% | 0.00% | NA |
| Aus | 269 | 58.00% | 42.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 19.50% | 80.00% | 0.17% | 0.34% | NA |
| Indica II | 465 | 5.80% | 93.30% | 0.43% | 0.43% | NA |
| Indica III | 913 | 22.20% | 77.00% | 0.44% | 0.33% | NA |
| Indica Intermediate | 786 | 29.00% | 70.40% | 0.13% | 0.51% | NA |
| Temperate Japonica | 767 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 0.80% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 43.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617703446 | C -> T | LOC_Os06g30590.1 | upstream_gene_variant ; 4135.0bp to feature; MODIFIER | silent_mutation | Average:47.296; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0617703446 | C -> T | LOC_Os06g30600.1 | upstream_gene_variant ; 1654.0bp to feature; MODIFIER | silent_mutation | Average:47.296; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0617703446 | C -> T | LOC_Os06g30610.1 | downstream_gene_variant ; 4126.0bp to feature; MODIFIER | silent_mutation | Average:47.296; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0617703446 | C -> T | LOC_Os06g30590-LOC_Os06g30600 | intergenic_region ; MODIFIER | silent_mutation | Average:47.296; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0617703446 | C -> DEL | N | N | silent_mutation | Average:47.296; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617703446 | NA | 6.26E-06 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617703446 | NA | 2.31E-06 | mr1354 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617703446 | NA | 5.30E-06 | mr1134_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617703446 | NA | 1.69E-09 | mr1172_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617703446 | NA | 5.76E-14 | mr1454_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617703446 | NA | 8.33E-06 | mr1462_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |