| Variant ID: vg0617693637 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 17693637 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TATTGTGTGCGTATGGGATGTGGAGTCGAATTTGGAAGGAGTCCAAATTTGGTACGATTGATTATGTAAAGTTTCTTTCTTGTACTAATGGGTTTTCTAA[A/G]
GTGTTTAGGACTCCTAGTATGAGTTTGGTTCGTGGCTTTAGGCTGCCTACCTCATGTATAAATAGAGGGGGAGCGTGAGGCTTCCCGGTACCGCTTTAGA
TCTAAAGCGGTACCGGGAAGCCTCACGCTCCCCCTCTATTTATACATGAGGTAGGCAGCCTAAAGCCACGAACCAAACTCATACTAGGAGTCCTAAACAC[T/C]
TTAGAAAACCCATTAGTACAAGAAAGAAACTTTACATAATCAATCGTACCAAATTTGGACTCCTTCCAAATTCGACTCCACATCCCATACGCACACAATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.00% | 32.80% | 2.12% | 4.13% | NA |
| All Indica | 2759 | 86.80% | 3.60% | 3.26% | 6.38% | NA |
| All Japonica | 1512 | 5.70% | 93.60% | 0.20% | 0.53% | NA |
| Aus | 269 | 97.00% | 0.40% | 1.12% | 1.49% | NA |
| Indica I | 595 | 87.20% | 4.40% | 4.71% | 3.70% | NA |
| Indica II | 465 | 74.80% | 4.30% | 5.38% | 15.48% | NA |
| Indica III | 913 | 94.30% | 1.20% | 1.10% | 3.40% | NA |
| Indica Intermediate | 786 | 84.90% | 5.20% | 3.44% | 6.49% | NA |
| Temperate Japonica | 767 | 2.30% | 96.50% | 0.13% | 1.04% | NA |
| Tropical Japonica | 504 | 12.30% | 87.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 96.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 36.70% | 4.44% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617693637 | A -> G | LOC_Os06g30570.1 | downstream_gene_variant ; 3790.0bp to feature; MODIFIER | silent_mutation | Average:16.4; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg0617693637 | A -> G | LOC_Os06g30580.1 | downstream_gene_variant ; 2687.0bp to feature; MODIFIER | silent_mutation | Average:16.4; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg0617693637 | A -> G | LOC_Os06g30590.1 | downstream_gene_variant ; 4458.0bp to feature; MODIFIER | silent_mutation | Average:16.4; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg0617693637 | A -> G | LOC_Os06g30580-LOC_Os06g30590 | intergenic_region ; MODIFIER | silent_mutation | Average:16.4; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| vg0617693637 | A -> DEL | N | N | silent_mutation | Average:16.4; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617693637 | 2.22E-07 | NA | mr1033 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617693637 | NA | 6.54E-08 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617693637 | NA | 3.44E-18 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617693637 | NA | 5.26E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617693637 | NA | 5.57E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617693637 | 4.08E-16 | 8.49E-108 | mr1033_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617693637 | 9.38E-10 | 2.42E-17 | mr1033_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617693637 | 4.20E-08 | NA | mr1033_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617693637 | NA | 9.94E-06 | mr1064_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617693637 | NA | 3.98E-24 | mr1403_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617693637 | 2.19E-06 | NA | mr1536_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617693637 | 1.48E-06 | NA | mr1536_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |