\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617662889:

Variant ID: vg0617662889 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17662889
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTATCTGATCGGCTATGCTATAAACATATATAGTCCTGTTATTGATATATATTTTGATCTAAGTGATTTATACTGTCTCGACATGGCGACCGATCTATCC[C/T]
AATCACTTGATTTAAGTATATATCGATATAAGGAGTATATATTGTTAATATCTACAGCCGATCGAGTAGATTTAATTCCTTCTTACTTATTCATGACTGC

Reverse complement sequence

GCAGTCATGAATAAGTAAGAAGGAATTAAATCTACTCGATCGGCTGTAGATATTAACAATATATACTCCTTATATCGATATATACTTAAATCAAGTGATT[G/A]
GGATAGATCGGTCGCCATGTCGAGACAGTATAAATCACTTAGATCAAAATATATATCAATAACAGGACTATATATGTTTATAGCATAGCCGATCAGATAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.80% 16.10% 0.13% 0.00% NA
All Indica  2759 86.80% 13.20% 0.04% 0.00% NA
All Japonica  1512 75.50% 24.30% 0.20% 0.00% NA
Aus  269 92.60% 7.40% 0.00% 0.00% NA
Indica I  595 86.40% 13.60% 0.00% 0.00% NA
Indica II  465 96.10% 3.70% 0.22% 0.00% NA
Indica III  913 82.70% 17.30% 0.00% 0.00% NA
Indica Intermediate  786 86.40% 13.60% 0.00% 0.00% NA
Temperate Japonica  767 98.20% 1.80% 0.00% 0.00% NA
Tropical Japonica  504 39.70% 59.70% 0.60% 0.00% NA
Japonica Intermediate  241 78.40% 21.60% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 90.00% 7.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617662889 C -> T LOC_Os06g30520.1 upstream_gene_variant ; 1447.0bp to feature; MODIFIER silent_mutation Average:22.773; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0617662889 C -> T LOC_Os06g30520-LOC_Os06g30530 intergenic_region ; MODIFIER silent_mutation Average:22.773; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617662889 NA 5.73E-06 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617662889 NA 8.94E-08 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617662889 NA 4.49E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617662889 NA 1.25E-06 mr1291 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617662889 NA 1.10E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617662889 NA 1.83E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617662889 NA 8.14E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617662889 NA 2.76E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617662889 NA 1.46E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617662889 NA 3.55E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617662889 NA 9.89E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617662889 NA 4.89E-06 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251