\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617644616:

Variant ID: vg0617644616 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17644616
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTACTTGTCAAGCCGATGTTATTAAACACATGTTGCAAAGGCCAATTCTAAGTGGGAGAATTGGCAAGTGGGCATATGCTCTGATAGAATATTATTTG[A/G]
CTTATGAACCATTGAAATCTATGAAAGGCCAAATTGTATGTGATTTTATAGTAGACCATCATATAGATATTGCTTATGAGGGGGAGGTTTGCTTAGTTGA

Reverse complement sequence

TCAACTAAGCAAACCTCCCCCTCATAAGCAATATCTATATGATGGTCTACTATAAAATCACATACAATTTGGCCTTTCATAGATTTCAATGGTTCATAAG[T/C]
CAAATAATATTCTATCAGAGCATATGCCCACTTGCCAATTCTCCCACTTAGAATTGGCCTTTGCAACATGTGTTTAATAACATCGGCTTGACAAGTAACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.60% 9.90% 9.01% 46.49% NA
All Indica  2759 8.00% 9.20% 11.38% 71.40% NA
All Japonica  1512 88.30% 8.80% 0.33% 2.58% NA
Aus  269 15.60% 3.30% 34.20% 46.84% NA
Indica I  595 13.60% 6.60% 10.25% 69.58% NA
Indica II  465 9.20% 3.20% 1.51% 86.02% NA
Indica III  913 1.80% 13.90% 16.21% 68.13% NA
Indica Intermediate  786 10.40% 9.20% 12.47% 67.94% NA
Temperate Japonica  767 95.80% 0.10% 0.13% 3.91% NA
Tropical Japonica  504 76.40% 22.60% 0.40% 0.60% NA
Japonica Intermediate  241 89.20% 7.50% 0.83% 2.49% NA
VI/Aromatic  96 4.20% 60.40% 9.38% 26.04% NA
Intermediate  90 37.80% 14.40% 6.67% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617644616 A -> G LOC_Os06g30510.1 intron_variant ; MODIFIER silent_mutation Average:9.296; most accessible tissue: Zhenshan97 flower, score: 15.748 N N N N
vg0617644616 A -> DEL N N silent_mutation Average:9.296; most accessible tissue: Zhenshan97 flower, score: 15.748 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617644616 6.08E-06 NA mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617644616 NA 2.74E-08 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617644616 NA 7.81E-09 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617644616 5.50E-06 NA mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617644616 8.32E-06 NA mr1112 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617644616 NA 1.46E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617644616 NA 2.09E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617644616 NA 1.32E-07 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617644616 NA 1.74E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617644616 NA 4.97E-06 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617644616 3.09E-06 NA mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617644616 1.30E-06 NA mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617644616 2.99E-06 NA mr1111_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617644616 3.14E-06 1.66E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617644616 9.53E-06 NA mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617644616 NA 1.15E-06 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617644616 7.27E-06 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617644616 NA 4.02E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251