Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0617636590:

Variant ID: vg0617636590 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17636590
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCCGCGCGGTTCTTCTCACCGTAAACAGAGTCCACCAGCCGCTGCTCACGTGGTTTGGGCTGAAGACGACGTGGTGGCCCAAATCTGTGAAACCCGGT[T/C]
CAAAGTGCAATGGAAGGTAATATTACCCGGTGTTATGTGAAAATATGGGCCTCGGCCTGGTCCATAGTGAAACTTTGGCTATTAAATCTGGCTCAAAGTG

Reverse complement sequence

CACTTTGAGCCAGATTTAATAGCCAAAGTTTCACTATGGACCAGGCCGAGGCCCATATTTTCACATAACACCGGGTAATATTACCTTCCATTGCACTTTG[A/G]
ACCGGGTTTCACAGATTTGGGCCACCACGTCGTCTTCAGCCCAAACCACGTGAGCAGCGGCTGGTGGACTCTGTTTACGGTGAGAAGAACCGCGCGGGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.50% 9.90% 0.44% 59.16% NA
All Indica  2759 2.60% 9.00% 0.69% 87.75% NA
All Japonica  1512 86.60% 8.90% 0.07% 4.50% NA
Aus  269 10.80% 5.20% 0.00% 84.01% NA
Indica I  595 3.40% 6.10% 1.01% 89.58% NA
Indica II  465 3.20% 2.80% 0.86% 93.12% NA
Indica III  913 0.40% 14.00% 0.22% 85.32% NA
Indica Intermediate  786 4.10% 9.00% 0.89% 86.01% NA
Temperate Japonica  767 93.00% 0.10% 0.00% 6.91% NA
Tropical Japonica  504 76.00% 22.60% 0.20% 1.19% NA
Japonica Intermediate  241 88.40% 7.90% 0.00% 3.73% NA
VI/Aromatic  96 1.00% 59.40% 0.00% 39.58% NA
Intermediate  90 35.60% 15.60% 1.11% 47.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617636590 T -> C LOC_Os06g30500.1 upstream_gene_variant ; 4244.0bp to feature; MODIFIER silent_mutation Average:44.374; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg0617636590 T -> C LOC_Os06g30510.1 upstream_gene_variant ; 2801.0bp to feature; MODIFIER silent_mutation Average:44.374; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg0617636590 T -> C LOC_Os06g30500-LOC_Os06g30510 intergenic_region ; MODIFIER silent_mutation Average:44.374; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg0617636590 T -> DEL N N silent_mutation Average:44.374; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617636590 2.56E-06 NA mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 2.95E-06 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 9.82E-07 3.97E-10 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 8.61E-07 3.11E-09 mr1078 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 1.02E-06 5.32E-09 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 NA 7.87E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 7.08E-06 NA mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 9.12E-06 NA mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 NA 2.21E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 7.21E-06 NA mr1108 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 5.25E-06 NA mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 1.71E-06 NA mr1112 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 8.06E-06 NA mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 9.32E-07 NA mr1121 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 1.87E-06 4.29E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 NA 2.92E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 1.21E-06 NA mr1200 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 2.68E-06 1.09E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 1.08E-06 NA mr1234 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 1.43E-06 NA mr1234 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 3.10E-07 NA mr1526 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 1.79E-06 2.85E-08 mr1526 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 NA 1.17E-06 mr1695 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 1.03E-06 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 7.23E-06 1.72E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 1.11E-06 2.07E-09 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 NA 3.03E-10 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 NA 2.15E-06 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 NA 2.38E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 NA 3.34E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 9.68E-07 NA mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 NA 1.20E-06 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 6.68E-06 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 NA 3.17E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 1.44E-06 NA mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 NA 4.23E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 7.21E-06 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 NA 1.86E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 NA 6.34E-07 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 8.02E-06 NA mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 NA 2.67E-09 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590 1.54E-06 6.24E-07 mr1695_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251