Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617636590:

Variant ID: vg0617636590 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 17636590
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCCGCGCGGTTCTTCTCACCGTAAACAGAGTCCACCAGCCGCTGCTCACGTGGTTTGGGCTGAAGACGACGTGGTGGCCCAAATCTGTGAAACCCGGT[T/C]
CAAAGTGCAATGGAAGGTAATATTACCCGGTGTTATGTGAAAATATGGGCCTCGGCCTGGTCCATAGTGAAACTTTGGCTATTAAATCTGGCTCAAAGTG

Reverse complement sequence

CACTTTGAGCCAGATTTAATAGCCAAAGTTTCACTATGGACCAGGCCGAGGCCCATATTTTCACATAACACCGGGTAATATTACCTTCCATTGCACTTTG[A/G]
ACCGGGTTTCACAGATTTGGGCCACCACGTCGTCTTCAGCCCAAACCACGTGAGCAGCGGCTGGTGGACTCTGTTTACGGTGAGAAGAACCGCGCGGGAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	30.50%	9.90%	0.44%	59.16%	NA
All Indica	2759	2.60%	9.00%	0.69%	87.75%	NA
All Japonica	1512	86.60%	8.90%	0.07%	4.50%	NA
Aus	269	10.80%	5.20%	0.00%	84.01%	NA
Indica I	595	3.40%	6.10%	1.01%	89.58%	NA
Indica II	465	3.20%	2.80%	0.86%	93.12%	NA
Indica III	913	0.40%	14.00%	0.22%	85.32%	NA
Indica Intermediate	786	4.10%	9.00%	0.89%	86.01%	NA
Temperate Japonica	767	93.00%	0.10%	0.00%	6.91%	NA
Tropical Japonica	504	76.00%	22.60%	0.20%	1.19%	NA
Japonica Intermediate	241	88.40%	7.90%	0.00%	3.73%	NA
VI/Aromatic	96	1.00%	59.40%	0.00%	39.58%	NA
Intermediate	90	35.60%	15.60%	1.11%	47.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0617636590	T -> C	LOC_Os06g30500.1	upstream_gene_variant ; 4244.0bp to feature; MODIFIER	silent_mutation	Average:44.374; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N
vg0617636590	T -> C	LOC_Os06g30510.1	upstream_gene_variant ; 2801.0bp to feature; MODIFIER	silent_mutation	Average:44.374; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N
vg0617636590	T -> C	LOC_Os06g30500-LOC_Os06g30510	intergenic_region ; MODIFIER	silent_mutation	Average:44.374; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N
vg0617636590	T -> DEL	N	N	silent_mutation	Average:44.374; most accessible tissue: Minghui63 young leaf, score: 57.221	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0617636590	2.56E-06	NA	mr1065	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	2.95E-06	NA	mr1068	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	9.82E-07	3.97E-10	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	8.61E-07	3.11E-09	mr1078	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	1.02E-06	5.32E-09	mr1087	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	NA	7.87E-07	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	7.08E-06	NA	mr1091	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	9.12E-06	NA	mr1096	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	NA	2.21E-07	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	7.21E-06	NA	mr1108	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	5.25E-06	NA	mr1108	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	1.71E-06	NA	mr1112	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	8.06E-06	NA	mr1112	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	9.32E-07	NA	mr1121	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	1.87E-06	4.29E-07	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	NA	2.92E-07	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	1.21E-06	NA	mr1200	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	2.68E-06	1.09E-06	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	1.08E-06	NA	mr1234	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	1.43E-06	NA	mr1234	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	3.10E-07	NA	mr1526	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	1.79E-06	2.85E-08	mr1526	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	NA	1.17E-06	mr1695	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	1.03E-06	NA	mr1068_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	7.23E-06	1.72E-09	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	1.11E-06	2.07E-09	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	NA	3.03E-10	mr1087_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	NA	2.15E-06	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	NA	2.38E-06	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	NA	3.34E-07	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	9.68E-07	NA	mr1108_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	NA	1.20E-06	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	6.68E-06	NA	mr1111_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	NA	3.17E-07	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	1.44E-06	NA	mr1112_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	NA	4.23E-06	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	7.21E-06	NA	mr1144_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	NA	1.86E-06	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	NA	6.34E-07	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	8.02E-06	NA	mr1234_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	NA	2.67E-09	mr1526_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636590	1.54E-06	6.24E-07	mr1695_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251