\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617636577:

Variant ID: vg0617636577 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17636577
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, T: 0.13, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


CCTAGCGCGTGACTTCCCGCGCGGTTCTTCTCACCGTAAACAGAGTCCACCAGCCGCTGCTCACGTGGTTTGGGCTGAAGACGACGTGGTGGCCCAAATC[T/A]
GTGAAACCCGGTTCAAAGTGCAATGGAAGGTAATATTACCCGGTGTTATGTGAAAATATGGGCCTCGGCCTGGTCCATAGTGAAACTTTGGCTATTAAAT

Reverse complement sequence

ATTTAATAGCCAAAGTTTCACTATGGACCAGGCCGAGGCCCATATTTTCACATAACACCGGGTAATATTACCTTCCATTGCACTTTGAACCGGGTTTCAC[A/T]
GATTTGGGCCACCACGTCGTCTTCAGCCCAAACCACGTGAGCAGCGGCTGGTGGACTCTGTTTACGGTGAGAAGAACCGCGCGGGAAGTCACGCGCTAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.50% 9.90% 0.42% 59.18% NA
All Indica  2759 2.60% 9.00% 0.65% 87.79% NA
All Japonica  1512 86.60% 8.80% 0.07% 4.50% NA
Aus  269 10.80% 5.20% 0.00% 84.01% NA
Indica I  595 3.40% 6.10% 1.01% 89.58% NA
Indica II  465 3.20% 2.80% 0.86% 93.12% NA
Indica III  913 0.30% 14.00% 0.22% 85.43% NA
Indica Intermediate  786 4.20% 9.00% 0.76% 86.01% NA
Temperate Japonica  767 93.00% 0.10% 0.00% 6.91% NA
Tropical Japonica  504 76.20% 22.40% 0.20% 1.19% NA
Japonica Intermediate  241 88.40% 7.90% 0.00% 3.73% NA
VI/Aromatic  96 1.00% 59.40% 0.00% 39.58% NA
Intermediate  90 35.60% 15.60% 1.11% 47.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617636577 T -> A LOC_Os06g30500.1 upstream_gene_variant ; 4231.0bp to feature; MODIFIER silent_mutation Average:44.458; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg0617636577 T -> A LOC_Os06g30510.1 upstream_gene_variant ; 2814.0bp to feature; MODIFIER silent_mutation Average:44.458; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg0617636577 T -> A LOC_Os06g30500-LOC_Os06g30510 intergenic_region ; MODIFIER silent_mutation Average:44.458; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg0617636577 T -> DEL N N silent_mutation Average:44.458; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617636577 5.27E-06 1.28E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 3.73E-06 4.29E-09 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 NA 3.68E-08 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 NA 7.19E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 8.88E-06 NA mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 NA 1.97E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 3.45E-06 NA mr1112 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 NA 4.98E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 9.53E-07 NA mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 1.46E-06 3.27E-07 mr1121 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 NA 3.01E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 3.26E-06 NA mr1200 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 6.07E-06 1.44E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 5.24E-06 NA mr1234 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 6.36E-06 NA mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 NA 5.79E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 1.06E-06 NA mr1526 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 6.83E-06 7.12E-08 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 5.17E-06 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 NA 2.88E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 NA 6.46E-09 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 NA 2.85E-09 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 NA 8.22E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 9.23E-06 NA mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 NA 5.80E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 NA 4.98E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 NA 9.63E-07 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636577 NA 1.85E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251