\
| Variant ID: vg0617636577 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 17636577 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, T: 0.13, others allele: 0.00, population size: 63. )
CCTAGCGCGTGACTTCCCGCGCGGTTCTTCTCACCGTAAACAGAGTCCACCAGCCGCTGCTCACGTGGTTTGGGCTGAAGACGACGTGGTGGCCCAAATC[T/A]
GTGAAACCCGGTTCAAAGTGCAATGGAAGGTAATATTACCCGGTGTTATGTGAAAATATGGGCCTCGGCCTGGTCCATAGTGAAACTTTGGCTATTAAAT
ATTTAATAGCCAAAGTTTCACTATGGACCAGGCCGAGGCCCATATTTTCACATAACACCGGGTAATATTACCTTCCATTGCACTTTGAACCGGGTTTCAC[A/T]
GATTTGGGCCACCACGTCGTCTTCAGCCCAAACCACGTGAGCAGCGGCTGGTGGACTCTGTTTACGGTGAGAAGAACCGCGCGGGAAGTCACGCGCTAGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.50% | 9.90% | 0.42% | 59.18% | NA |
| All Indica | 2759 | 2.60% | 9.00% | 0.65% | 87.79% | NA |
| All Japonica | 1512 | 86.60% | 8.80% | 0.07% | 4.50% | NA |
| Aus | 269 | 10.80% | 5.20% | 0.00% | 84.01% | NA |
| Indica I | 595 | 3.40% | 6.10% | 1.01% | 89.58% | NA |
| Indica II | 465 | 3.20% | 2.80% | 0.86% | 93.12% | NA |
| Indica III | 913 | 0.30% | 14.00% | 0.22% | 85.43% | NA |
| Indica Intermediate | 786 | 4.20% | 9.00% | 0.76% | 86.01% | NA |
| Temperate Japonica | 767 | 93.00% | 0.10% | 0.00% | 6.91% | NA |
| Tropical Japonica | 504 | 76.20% | 22.40% | 0.20% | 1.19% | NA |
| Japonica Intermediate | 241 | 88.40% | 7.90% | 0.00% | 3.73% | NA |
| VI/Aromatic | 96 | 1.00% | 59.40% | 0.00% | 39.58% | NA |
| Intermediate | 90 | 35.60% | 15.60% | 1.11% | 47.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617636577 | T -> A | LOC_Os06g30500.1 | upstream_gene_variant ; 4231.0bp to feature; MODIFIER | silent_mutation | Average:44.458; most accessible tissue: Minghui63 young leaf, score: 57.221 | N | N | N | N |
| vg0617636577 | T -> A | LOC_Os06g30510.1 | upstream_gene_variant ; 2814.0bp to feature; MODIFIER | silent_mutation | Average:44.458; most accessible tissue: Minghui63 young leaf, score: 57.221 | N | N | N | N |
| vg0617636577 | T -> A | LOC_Os06g30500-LOC_Os06g30510 | intergenic_region ; MODIFIER | silent_mutation | Average:44.458; most accessible tissue: Minghui63 young leaf, score: 57.221 | N | N | N | N |
| vg0617636577 | T -> DEL | N | N | silent_mutation | Average:44.458; most accessible tissue: Minghui63 young leaf, score: 57.221 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617636577 | 5.27E-06 | 1.28E-09 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | 3.73E-06 | 4.29E-09 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | NA | 3.68E-08 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | NA | 7.19E-07 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | 8.88E-06 | NA | mr1108 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | NA | 1.97E-06 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | 3.45E-06 | NA | mr1112 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | NA | 4.98E-08 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | 9.53E-07 | NA | mr1121 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | 1.46E-06 | 3.27E-07 | mr1121 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | NA | 3.01E-07 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | 3.26E-06 | NA | mr1200 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | 6.07E-06 | 1.44E-06 | mr1200 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | 5.24E-06 | NA | mr1234 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | 6.36E-06 | NA | mr1234 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | NA | 5.79E-07 | mr1237 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | 1.06E-06 | NA | mr1526 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | 6.83E-06 | 7.12E-08 | mr1526 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | 5.17E-06 | NA | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | NA | 2.88E-09 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | NA | 6.46E-09 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | NA | 2.85E-09 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | NA | 8.22E-07 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | 9.23E-06 | NA | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | NA | 5.80E-07 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | NA | 4.98E-06 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | NA | 9.63E-07 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617636577 | NA | 1.85E-08 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |