\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617636450:

Variant ID: vg0617636450 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17636450
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACACAGGTGAAATCCTGATTAGGCCGACCATATCCAAATCAGGGCAGTGCTGTAGCCAGGGGGAGGGAGGGCTGCCATCTACTGAGTGGGTGGTGGCGCT[A/G]
GAACCCTCGTGGCGTCAGCTTCGCGCCCTAGCGCGTGACTTCCCGCGCGGTTCTTCTCACCGTAAACAGAGTCCACCAGCCGCTGCTCACGTGGTTTGGG

Reverse complement sequence

CCCAAACCACGTGAGCAGCGGCTGGTGGACTCTGTTTACGGTGAGAAGAACCGCGCGGGAAGTCACGCGCTAGGGCGCGAAGCTGACGCCACGAGGGTTC[T/C]
AGCGCCACCACCCACTCAGTAGATGGCAGCCCTCCCTCCCCCTGGCTACAGCACTGCCCTGATTTGGATATGGTCGGCCTAATCAGGATTTCACCTGTGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.70% 9.70% 0.44% 59.12% NA
All Indica  2759 2.70% 8.80% 0.58% 87.86% NA
All Japonica  1512 86.60% 8.90% 0.07% 4.43% NA
Aus  269 11.50% 4.80% 0.74% 82.90% NA
Indica I  595 3.40% 6.20% 0.84% 89.58% NA
Indica II  465 3.00% 2.80% 0.43% 93.76% NA
Indica III  913 0.90% 13.70% 0.55% 84.88% NA
Indica Intermediate  786 4.20% 8.80% 0.51% 86.51% NA
Temperate Japonica  767 93.00% 0.10% 0.13% 6.78% NA
Tropical Japonica  504 76.00% 22.60% 0.00% 1.39% NA
Japonica Intermediate  241 88.80% 7.90% 0.00% 3.32% NA
VI/Aromatic  96 1.00% 60.40% 0.00% 38.54% NA
Intermediate  90 37.80% 12.20% 2.22% 47.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617636450 A -> G LOC_Os06g30500.1 upstream_gene_variant ; 4104.0bp to feature; MODIFIER silent_mutation Average:52.489; most accessible tissue: Callus, score: 72.857 N N N N
vg0617636450 A -> G LOC_Os06g30510.1 upstream_gene_variant ; 2941.0bp to feature; MODIFIER silent_mutation Average:52.489; most accessible tissue: Callus, score: 72.857 N N N N
vg0617636450 A -> G LOC_Os06g30500-LOC_Os06g30510 intergenic_region ; MODIFIER silent_mutation Average:52.489; most accessible tissue: Callus, score: 72.857 N N N N
vg0617636450 A -> DEL N N silent_mutation Average:52.489; most accessible tissue: Callus, score: 72.857 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617636450 NA 9.13E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 1.69E-06 1.85E-09 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 NA 1.65E-07 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 NA 1.82E-06 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 NA 2.34E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 NA 6.37E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 NA 6.69E-08 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 NA 2.33E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 3.81E-06 NA mr1112 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 6.73E-06 NA mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 NA 6.50E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 NA 6.87E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 6.62E-07 NA mr1200 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 7.89E-07 3.94E-07 mr1200 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 NA 7.72E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 NA 6.97E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 9.77E-06 NA mr1526 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 NA 2.46E-07 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 NA 4.19E-08 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 NA 2.16E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 NA 3.02E-06 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 NA 1.04E-06 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617636450 NA 5.55E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251