\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617611502:

Variant ID: vg0617611502 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17611502
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


TCCCCTTCGACCACCTCCACCACCATCGCACACCGTATCGCCTCTCCACTCTCTCCCCGGCGGCTGCAAATCGATCCCGGCTGGACGTGACTAGGTTGGC[G/A]
ACTAGACTCATCCCTCATGCCATCTATCTCTCCAATATAATATAGTTCTAGGTAAGTTCTGCTGAATGCATATGCTGCCATGTTTTATCTTCATAATAAC

Reverse complement sequence

GTTATTATGAAGATAAAACATGGCAGCATATGCATTCAGCAGAACTTACCTAGAACTATATTATATTGGAGAGATAGATGGCATGAGGGATGAGTCTAGT[C/T]
GCCAACCTAGTCACGTCCAGCCGGGATCGATTTGCAGCCGCCGGGGAGAGAGTGGAGAGGCGATACGGTGTGCGATGGTGGTGGAGGTGGTCGAAGGGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.50% 4.80% 1.46% 4.30% NA
All Indica  2759 90.80% 7.50% 1.34% 0.36% NA
All Japonica  1512 84.80% 0.80% 1.85% 12.57% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 98.70% 0.00% 1.34% 0.00% NA
Indica II  465 89.50% 7.50% 2.58% 0.43% NA
Indica III  913 87.20% 12.30% 0.55% 0.00% NA
Indica Intermediate  786 89.80% 7.60% 1.53% 1.02% NA
Temperate Japonica  767 96.70% 1.40% 0.13% 1.69% NA
Tropical Japonica  504 74.60% 0.00% 2.98% 22.42% NA
Japonica Intermediate  241 68.00% 0.40% 4.98% 26.56% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 88.90% 6.70% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617611502 G -> A LOC_Os06g30470.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:62.283; most accessible tissue: Minghui63 flag leaf, score: 77.153 N N N N
vg0617611502 G -> A LOC_Os06g30460.1 upstream_gene_variant ; 1827.0bp to feature; MODIFIER silent_mutation Average:62.283; most accessible tissue: Minghui63 flag leaf, score: 77.153 N N N N
vg0617611502 G -> A LOC_Os06g30460.4 upstream_gene_variant ; 1831.0bp to feature; MODIFIER silent_mutation Average:62.283; most accessible tissue: Minghui63 flag leaf, score: 77.153 N N N N
vg0617611502 G -> A LOC_Os06g30460.5 upstream_gene_variant ; 1831.0bp to feature; MODIFIER silent_mutation Average:62.283; most accessible tissue: Minghui63 flag leaf, score: 77.153 N N N N
vg0617611502 G -> A LOC_Os06g30460.2 upstream_gene_variant ; 1827.0bp to feature; MODIFIER silent_mutation Average:62.283; most accessible tissue: Minghui63 flag leaf, score: 77.153 N N N N
vg0617611502 G -> A LOC_Os06g30460.3 upstream_gene_variant ; 1827.0bp to feature; MODIFIER silent_mutation Average:62.283; most accessible tissue: Minghui63 flag leaf, score: 77.153 N N N N
vg0617611502 G -> DEL N N silent_mutation Average:62.283; most accessible tissue: Minghui63 flag leaf, score: 77.153 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617611502 1.22E-06 NA mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502 3.71E-08 2.21E-12 mr1090 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502 1.97E-06 7.39E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502 5.71E-07 2.12E-09 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502 NA 2.61E-09 mr1122 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502 1.10E-06 NA mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502 5.36E-09 1.58E-13 mr1211 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502 1.48E-07 NA mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502 2.30E-09 2.49E-11 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502 1.62E-06 NA mr1094_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502 6.07E-06 NA mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502 1.75E-07 NA mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502 1.88E-08 3.72E-10 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502 8.97E-08 NA mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502 2.20E-09 1.40E-13 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502 NA 9.90E-07 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251