Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617611502:

Variant ID: vg0617611502 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 17611502
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

TCCCCTTCGACCACCTCCACCACCATCGCACACCGTATCGCCTCTCCACTCTCTCCCCGGCGGCTGCAAATCGATCCCGGCTGGACGTGACTAGGTTGGC[G/A]
ACTAGACTCATCCCTCATGCCATCTATCTCTCCAATATAATATAGTTCTAGGTAAGTTCTGCTGAATGCATATGCTGCCATGTTTTATCTTCATAATAAC

Reverse complement sequence

GTTATTATGAAGATAAAACATGGCAGCATATGCATTCAGCAGAACTTACCTAGAACTATATTATATTGGAGAGATAGATGGCATGAGGGATGAGTCTAGT[C/T]
GCCAACCTAGTCACGTCCAGCCGGGATCGATTTGCAGCCGCCGGGGAGAGAGTGGAGAGGCGATACGGTGTGCGATGGTGGTGGAGGTGGTCGAAGGGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.50%	4.80%	1.46%	4.30%	NA
All Indica	2759	90.80%	7.50%	1.34%	0.36%	NA
All Japonica	1512	84.80%	0.80%	1.85%	12.57%	NA
Aus	269	99.30%	0.00%	0.74%	0.00%	NA
Indica I	595	98.70%	0.00%	1.34%	0.00%	NA
Indica II	465	89.50%	7.50%	2.58%	0.43%	NA
Indica III	913	87.20%	12.30%	0.55%	0.00%	NA
Indica Intermediate	786	89.80%	7.60%	1.53%	1.02%	NA
Temperate Japonica	767	96.70%	1.40%	0.13%	1.69%	NA
Tropical Japonica	504	74.60%	0.00%	2.98%	22.42%	NA
Japonica Intermediate	241	68.00%	0.40%	4.98%	26.56%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	88.90%	6.70%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0617611502	G -> A	LOC_Os06g30470.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:62.283; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg0617611502	G -> A	LOC_Os06g30460.1	upstream_gene_variant ; 1827.0bp to feature; MODIFIER	silent_mutation	Average:62.283; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg0617611502	G -> A	LOC_Os06g30460.4	upstream_gene_variant ; 1831.0bp to feature; MODIFIER	silent_mutation	Average:62.283; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg0617611502	G -> A	LOC_Os06g30460.5	upstream_gene_variant ; 1831.0bp to feature; MODIFIER	silent_mutation	Average:62.283; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg0617611502	G -> A	LOC_Os06g30460.2	upstream_gene_variant ; 1827.0bp to feature; MODIFIER	silent_mutation	Average:62.283; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg0617611502	G -> A	LOC_Os06g30460.3	upstream_gene_variant ; 1827.0bp to feature; MODIFIER	silent_mutation	Average:62.283; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N
vg0617611502	G -> DEL	N	N	silent_mutation	Average:62.283; most accessible tissue: Minghui63 flag leaf, score: 77.153	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0617611502	1.22E-06	NA	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502	3.71E-08	2.21E-12	mr1090	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502	1.97E-06	7.39E-07	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502	5.71E-07	2.12E-09	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502	NA	2.61E-09	mr1122	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502	1.10E-06	NA	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502	5.36E-09	1.58E-13	mr1211	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502	1.48E-07	NA	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502	2.30E-09	2.49E-11	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502	1.62E-06	NA	mr1094_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502	6.07E-06	NA	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502	1.75E-07	NA	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502	1.88E-08	3.72E-10	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502	8.97E-08	NA	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502	2.20E-09	1.40E-13	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617611502	NA	9.90E-07	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251