Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617608061:

Variant ID: vg0617608061 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17608061
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.81, G: 0.19, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGGGGCGTAATCTCAGCCCTAGTCCATCTGAGCACCCGTCACTCGACCGGGGTCGCGCACAGTATGCCTCTCGCTCGCCTCTGAGCTCGCAGGCAACA[G/A]
CGTATGCGAGTTGAGGTAAAAGAAACGGGAGACAAGGATTTTTATACAGGTTTGATCGAAACCAGTGTTGCCATTATATATCAATATCACACGAGTACAC

Reverse complement sequence

GTGTACTCGTGTGATATTGATATATAATGGCAACACTGGTTTCGATCAAACCTGTATAAAAATCCTTGTCTCCCGTTTCTTTTACCTCAACTCGCATACG[C/T]
TGTTGCCTGCGAGCTCAGAGGCGAGCGAGAGGCATACTGTGCGCGACCCCGGTCGAGTGACGGGTGCTCAGATGGACTAGGGCTGAGATTACGCCCCCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.50% 12.40% 0.15% 0.00% NA
All Indica  2759 91.80% 8.20% 0.00% 0.00% NA
All Japonica  1512 88.80% 10.80% 0.46% 0.00% NA
Aus  269 53.90% 46.10% 0.00% 0.00% NA
Indica I  595 92.80% 7.20% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 87.40% 12.60% 0.00% 0.00% NA
Indica Intermediate  786 92.70% 7.30% 0.00% 0.00% NA
Temperate Japonica  767 95.20% 4.20% 0.65% 0.00% NA
Tropical Japonica  504 77.40% 22.40% 0.20% 0.00% NA
Japonica Intermediate  241 92.10% 7.50% 0.41% 0.00% NA
VI/Aromatic  96 39.60% 60.40% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617608061 G -> A LOC_Os06g30470.1 upstream_gene_variant ; 1736.0bp to feature; MODIFIER silent_mutation Average:80.339; most accessible tissue: Zhenshan97 young leaf, score: 90.638 N N N N
vg0617608061 G -> A LOC_Os06g30460.1 intron_variant ; MODIFIER silent_mutation Average:80.339; most accessible tissue: Zhenshan97 young leaf, score: 90.638 N N N N
vg0617608061 G -> A LOC_Os06g30460.4 intron_variant ; MODIFIER silent_mutation Average:80.339; most accessible tissue: Zhenshan97 young leaf, score: 90.638 N N N N
vg0617608061 G -> A LOC_Os06g30460.5 intron_variant ; MODIFIER silent_mutation Average:80.339; most accessible tissue: Zhenshan97 young leaf, score: 90.638 N N N N
vg0617608061 G -> A LOC_Os06g30460.2 intron_variant ; MODIFIER silent_mutation Average:80.339; most accessible tissue: Zhenshan97 young leaf, score: 90.638 N N N N
vg0617608061 G -> A LOC_Os06g30460.3 intron_variant ; MODIFIER silent_mutation Average:80.339; most accessible tissue: Zhenshan97 young leaf, score: 90.638 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0617608061 G A -0.04 -0.03 -0.03 -0.03 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617608061 NA 2.19E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617608061 2.51E-06 NA mr1096 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617608061 NA 3.94E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617608061 NA 1.02E-07 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617608061 NA 2.70E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617608061 NA 2.36E-06 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617608061 NA 1.20E-06 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617608061 NA 6.16E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617608061 NA 3.39E-08 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251