Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617571208:

Variant ID: vg0617571208 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17571208
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTATATCTGACGTGTGAATTGAGTGTGGTATATATATAGGTTGTATGATTGGTATATATATATACATTAGTCTTGAGAATTTTTGTTACTTCTTCC[A/G]
TATGATGTTGTATATTTAAATATACGACGCTGTTGATTTACGGCTGCCTATATGATTAGCGCACCATAAGATGATTATTGAAAGAAAATGAAAAAGGTAT

Reverse complement sequence

ATACCTTTTTCATTTTCTTTCAATAATCATCTTATGGTGCGCTAATCATATAGGCAGCCGTAAATCAACAGCGTCGTATATTTAAATATACAACATCATA[T/C]
GGAAGAAGTAACAAAAATTCTCAAGACTAATGTATATATATATACCAATCATACAACCTATATATATACCACACTCAATTCACACGTCAGATATAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.40% 9.60% 3.05% 0.00% NA
All Indica  2759 99.70% 0.20% 0.14% 0.00% NA
All Japonica  1512 61.90% 29.20% 8.86% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 98.80% 0.80% 0.34% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.00% 0.25% 0.00% NA
Temperate Japonica  767 34.90% 52.30% 12.78% 0.00% NA
Tropical Japonica  504 93.50% 3.40% 3.17% 0.00% NA
Japonica Intermediate  241 81.70% 10.00% 8.30% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 6.70% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617571208 A -> G LOC_Os06g30400-LOC_Os06g30420 intergenic_region ; MODIFIER silent_mutation Average:61.992; most accessible tissue: Callus, score: 84.647 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0617571208 A G 0.04 0.0 0.02 0.01 0.03 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617571208 NA 8.17E-10 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 NA 4.89E-08 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 4.86E-08 1.09E-30 mr1137 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 NA 3.47E-11 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 NA 1.74E-13 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 NA 3.88E-07 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 NA 2.66E-10 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 NA 1.18E-08 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 2.18E-06 NA mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 NA 5.55E-09 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 NA 7.09E-13 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 NA 2.06E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 NA 7.01E-10 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 NA 4.88E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 NA 1.77E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 NA 9.73E-06 mr1995 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 NA 2.75E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 NA 1.07E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 1.15E-07 6.32E-32 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 NA 2.42E-10 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 NA 5.36E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 NA 1.92E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 8.54E-06 NA mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 NA 9.41E-08 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617571208 NA 3.95E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251