\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617467114:

Variant ID: vg0617467114 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17467114
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGATGTCTTCCTTCCACTCCGTGATTGTAATACCCCGTATATTAAAAGATACTTAGTTTTGTAGTTTGGTTTGACTTGTTTAAAATAAAGATGTTAACA[A/G,T]
AAATAAATAAAAGAAAATACCTTTTGAAGTAGGCCAACATGAGAAGGCCCATAAACCCAGCCCATTAGTTCTCCCCTAAAACCTAGAGAGAGGGGAACTG

Reverse complement sequence

CAGTTCCCCTCTCTCTAGGTTTTAGGGGAGAACTAATGGGCTGGGTTTATGGGCCTTCTCATGTTGGCCTACTTCAAAAGGTATTTTCTTTTATTTATTT[T/C,A]
TGTTAACATCTTTATTTTAAACAAGTCAAACCAAACTACAAAACTAAGTATCTTTTAATATACGGGGTATTACAATCACGGAGTGGAAGGAAGACATCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.20% 34.20% 3.20% 27.21% T: 0.21%
All Indica  2759 53.10% 3.60% 2.94% 40.09% T: 0.25%
All Japonica  1512 1.50% 95.60% 1.32% 1.59% NA
Aus  269 48.70% 12.60% 6.32% 31.97% T: 0.37%
Indica I  595 68.90% 5.00% 0.84% 25.04% T: 0.17%
Indica II  465 83.70% 3.00% 0.43% 12.90% NA
Indica III  913 23.90% 1.90% 5.91% 67.80% T: 0.55%
Indica Intermediate  786 57.10% 4.80% 2.54% 35.37% T: 0.13%
Temperate Japonica  767 1.60% 93.90% 2.35% 2.22% NA
Tropical Japonica  504 0.80% 98.40% 0.20% 0.60% NA
Japonica Intermediate  241 2.90% 95.00% 0.41% 1.66% NA
VI/Aromatic  96 16.70% 3.10% 28.12% 50.00% T: 2.08%
Intermediate  90 30.00% 38.90% 6.67% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617467114 A -> G LOC_Os06g30260.1 downstream_gene_variant ; 3134.0bp to feature; MODIFIER silent_mutation Average:65.457; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N
vg0617467114 A -> G LOC_Os06g30280.1 downstream_gene_variant ; 3618.0bp to feature; MODIFIER silent_mutation Average:65.457; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N
vg0617467114 A -> G LOC_Os06g30270.1 intron_variant ; MODIFIER silent_mutation Average:65.457; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N
vg0617467114 A -> T LOC_Os06g30260.1 downstream_gene_variant ; 3134.0bp to feature; MODIFIER silent_mutation Average:65.457; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N
vg0617467114 A -> T LOC_Os06g30280.1 downstream_gene_variant ; 3618.0bp to feature; MODIFIER silent_mutation Average:65.457; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N
vg0617467114 A -> T LOC_Os06g30270.1 intron_variant ; MODIFIER silent_mutation Average:65.457; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N
vg0617467114 A -> DEL N N silent_mutation Average:65.457; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617467114 NA 7.92E-78 mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617467114 NA 7.01E-11 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617467114 NA 2.84E-17 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617467114 NA 2.30E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617467114 NA 1.88E-36 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617467114 NA 9.99E-32 mr1137_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617467114 NA 2.94E-12 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617467114 NA 2.28E-53 mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617467114 NA 6.84E-61 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617467114 NA 6.76E-25 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617467114 NA 1.61E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617467114 NA 1.03E-18 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251