\
| Variant ID: vg0617467114 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 17467114 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGATGTCTTCCTTCCACTCCGTGATTGTAATACCCCGTATATTAAAAGATACTTAGTTTTGTAGTTTGGTTTGACTTGTTTAAAATAAAGATGTTAACA[A/G,T]
AAATAAATAAAAGAAAATACCTTTTGAAGTAGGCCAACATGAGAAGGCCCATAAACCCAGCCCATTAGTTCTCCCCTAAAACCTAGAGAGAGGGGAACTG
CAGTTCCCCTCTCTCTAGGTTTTAGGGGAGAACTAATGGGCTGGGTTTATGGGCCTTCTCATGTTGGCCTACTTCAAAAGGTATTTTCTTTTATTTATTT[T/C,A]
TGTTAACATCTTTATTTTAAACAAGTCAAACCAAACTACAAAACTAAGTATCTTTTAATATACGGGGTATTACAATCACGGAGTGGAAGGAAGACATCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.20% | 34.20% | 3.20% | 27.21% | T: 0.21% |
| All Indica | 2759 | 53.10% | 3.60% | 2.94% | 40.09% | T: 0.25% |
| All Japonica | 1512 | 1.50% | 95.60% | 1.32% | 1.59% | NA |
| Aus | 269 | 48.70% | 12.60% | 6.32% | 31.97% | T: 0.37% |
| Indica I | 595 | 68.90% | 5.00% | 0.84% | 25.04% | T: 0.17% |
| Indica II | 465 | 83.70% | 3.00% | 0.43% | 12.90% | NA |
| Indica III | 913 | 23.90% | 1.90% | 5.91% | 67.80% | T: 0.55% |
| Indica Intermediate | 786 | 57.10% | 4.80% | 2.54% | 35.37% | T: 0.13% |
| Temperate Japonica | 767 | 1.60% | 93.90% | 2.35% | 2.22% | NA |
| Tropical Japonica | 504 | 0.80% | 98.40% | 0.20% | 0.60% | NA |
| Japonica Intermediate | 241 | 2.90% | 95.00% | 0.41% | 1.66% | NA |
| VI/Aromatic | 96 | 16.70% | 3.10% | 28.12% | 50.00% | T: 2.08% |
| Intermediate | 90 | 30.00% | 38.90% | 6.67% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617467114 | A -> G | LOC_Os06g30260.1 | downstream_gene_variant ; 3134.0bp to feature; MODIFIER | silent_mutation | Average:65.457; most accessible tissue: Minghui63 flag leaf, score: 82.521 | N | N | N | N |
| vg0617467114 | A -> G | LOC_Os06g30280.1 | downstream_gene_variant ; 3618.0bp to feature; MODIFIER | silent_mutation | Average:65.457; most accessible tissue: Minghui63 flag leaf, score: 82.521 | N | N | N | N |
| vg0617467114 | A -> G | LOC_Os06g30270.1 | intron_variant ; MODIFIER | silent_mutation | Average:65.457; most accessible tissue: Minghui63 flag leaf, score: 82.521 | N | N | N | N |
| vg0617467114 | A -> T | LOC_Os06g30260.1 | downstream_gene_variant ; 3134.0bp to feature; MODIFIER | silent_mutation | Average:65.457; most accessible tissue: Minghui63 flag leaf, score: 82.521 | N | N | N | N |
| vg0617467114 | A -> T | LOC_Os06g30280.1 | downstream_gene_variant ; 3618.0bp to feature; MODIFIER | silent_mutation | Average:65.457; most accessible tissue: Minghui63 flag leaf, score: 82.521 | N | N | N | N |
| vg0617467114 | A -> T | LOC_Os06g30270.1 | intron_variant ; MODIFIER | silent_mutation | Average:65.457; most accessible tissue: Minghui63 flag leaf, score: 82.521 | N | N | N | N |
| vg0617467114 | A -> DEL | N | N | silent_mutation | Average:65.457; most accessible tissue: Minghui63 flag leaf, score: 82.521 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617467114 | NA | 7.92E-78 | mr1100 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617467114 | NA | 7.01E-11 | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617467114 | NA | 2.84E-17 | mr1253 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617467114 | NA | 2.30E-07 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617467114 | NA | 1.88E-36 | mr1402 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617467114 | NA | 9.99E-32 | mr1137_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617467114 | NA | 2.94E-12 | mr1138_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617467114 | NA | 2.28E-53 | mr1141_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617467114 | NA | 6.84E-61 | mr1402_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617467114 | NA | 6.76E-25 | mr1403_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617467114 | NA | 1.61E-26 | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617467114 | NA | 1.03E-18 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |