\
| Variant ID: vg0617413253 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 17413253 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTACCTGAAACATCAATAAAATTATGTATAGCAAAATAATTAACCCACTTGTAGTCCAACTTCTAAAATTCATAGAAAATTCATATTAGCTTCAAATATT[A/T]
TGAACTCAATCTTGTTAGGCTAATAACACCATTCAATTTAATTGGTAAAAACAGTAGGTACTGCACTTGTACAAAATCAGTCTCTAAAATCTTATATAGA
TCTATATAAGATTTTAGAGACTGATTTTGTACAAGTGCAGTACCTACTGTTTTTACCAATTAAATTGAATGGTGTTATTAGCCTAACAAGATTGAGTTCA[T/A]
AATATTTGAAGCTAATATGAATTTTCTATGAATTTTAGAAGTTGGACTACAAGTGGGTTAATTATTTTGCTATACATAATTTTATTGATGTTTCAGGTAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.30% | 37.60% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 2.30% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 2.80% | 97.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 55.00% | 45.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.10% | 2.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.80% | 3.90% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 22.90% | 77.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 53.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617413253 | A -> T | LOC_Os06g30160.1 | upstream_gene_variant ; 2479.0bp to feature; MODIFIER | silent_mutation | Average:28.804; most accessible tissue: Callus, score: 68.943 | N | N | N | N |
| vg0617413253 | A -> T | LOC_Os06g30179.1 | intron_variant ; MODIFIER | silent_mutation | Average:28.804; most accessible tissue: Callus, score: 68.943 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617413253 | NA | 2.05E-21 | mr1020 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 4.30E-40 | mr1064 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 2.39E-27 | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 8.53E-41 | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 6.39E-23 | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 4.90E-30 | mr1085 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 1.30E-30 | mr1086 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 1.52E-59 | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 1.69E-58 | mr1088 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 3.81E-61 | mr1103 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 8.88E-30 | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 5.90E-36 | mr1110 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 8.95E-40 | mr1139 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 4.69E-42 | mr1144 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 2.03E-29 | mr1145 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 2.02E-21 | mr1155 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 1.78E-18 | mr1179 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 1.61E-26 | mr1181 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 9.64E-32 | mr1204 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 3.74E-49 | mr1211 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 3.04E-32 | mr1225 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 5.19E-32 | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 1.57E-62 | mr1246 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 2.14E-24 | mr1264 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 4.29E-10 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 2.45E-25 | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 1.35E-27 | mr1426 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 7.33E-32 | mr1436 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 6.81E-41 | mr1437 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 5.29E-44 | mr1534 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 1.59E-19 | mr1541 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 1.62E-30 | mr1560 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 5.18E-12 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 4.60E-16 | mr1700 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 1.14E-40 | mr1890 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 1.21E-63 | mr1970 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 1.93E-85 | mr1973 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 2.43E-57 | mr1064_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 6.19E-33 | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 1.87E-69 | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 5.84E-75 | mr1088_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 7.12E-36 | mr1181_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 1.72E-38 | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 1.99E-38 | mr1264_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 3.41E-07 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 3.99E-10 | mr1782_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 2.84E-61 | mr1970_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617413253 | NA | 2.95E-99 | mr1973_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |