Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617375769:

Variant ID: vg0617375769 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 17375769
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, C: 0.04, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

AATTTATTAGATTGCCGTGTGGCGATATCGGAACATCTGTAGGAGTCCCACGTGGCGGCTTGAGAGCGTTTGTAGTAAGTTTAATAGACTTTTAGTATAT[C/A]
ATAGATAGATAGATTGAATATGTTTTTGCCGGTACTTTGATACGTCATCTGTGTTTGAGTCAGTTTTTAAGTTCAATCGCTTTTTAGAAATACAGGTCCG

Reverse complement sequence

CGGACCTGTATTTCTAAAAAGCGATTGAACTTAAAAACTGACTCAAACACAGATGACGTATCAAAGTACCGGCAAAAACATATTCAATCTATCTATCTAT[G/T]
ATATACTAAAAGTCTATTAAACTTACTACAAACGCTCTCAAGCCGCCACGTGGGACTCCTACAGATGTTCCGATATCGCCACACGGCAATCTAATAAATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.20%	30.10%	5.35%	1.35%	NA
All Indica	2759	88.60%	1.80%	8.37%	1.27%	NA
All Japonica	1512	9.60%	88.20%	0.46%	1.72%	NA
Aus	269	92.20%	3.00%	3.72%	1.12%	NA
Indica I	595	82.00%	2.70%	13.11%	2.18%	NA
Indica II	465	85.40%	0.60%	12.04%	1.94%	NA
Indica III	913	95.50%	0.20%	3.72%	0.55%	NA
Indica Intermediate	786	87.40%	3.60%	8.02%	1.02%	NA
Temperate Japonica	767	3.30%	93.00%	0.39%	3.39%	NA
Tropical Japonica	504	22.40%	77.20%	0.40%	0.00%	NA
Japonica Intermediate	241	2.90%	96.30%	0.83%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	61.10%	33.30%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0617375769	C -> A	LOC_Os06g30130.1	upstream_gene_variant ; 2528.0bp to feature; MODIFIER	silent_mutation	Average:18.049; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0617375769	C -> A	LOC_Os06g30130.2	upstream_gene_variant ; 2530.0bp to feature; MODIFIER	silent_mutation	Average:18.049; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0617375769	C -> A	LOC_Os06g30120-LOC_Os06g30130	intergenic_region ; MODIFIER	silent_mutation	Average:18.049; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0617375769	C -> DEL	N	N	silent_mutation	Average:18.049; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0617375769	1.04E-06	1.04E-06	mr1144	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617375769	NA	2.19E-06	mr1211	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617375769	NA	5.57E-36	mr1402	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617375769	NA	1.35E-36	mr1719	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617375769	NA	3.55E-34	mr1780	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617375769	NA	2.10E-07	mr1068_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617375769	8.37E-06	1.35E-08	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617375769	4.24E-06	2.78E-08	mr1211_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617375769	NA	8.96E-26	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617375769	NA	2.07E-18	mr1682_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617375769	NA	4.23E-21	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251