Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617344026:

Variant ID: vg0617344026 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 17344026
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAAAATTCAATATCTCCCTTTGGACTCATTTCCAAATATTGCCCTCGGTTCCGATAATACCAAATCCCCATTTTGAATCCCTTCGTCGACTCCTCCCTCT[T/C]
CCCCAAATCCAAAAATAACCGAGTCCACCTTGAATCTATTCCTTGGCTCCTCCGTATTTCGCTAAGTTCAAATATGCAATTTGAATTCAAACCTAAACTC

Reverse complement sequence

GAGTTTAGGTTTGAATTCAAATTGCATATTTGAACTTAGCGAAATACGGAGGAGCCAAGGAATAGATTCAAGGTGGACTCGGTTATTTTTGGATTTGGGG[A/G]
AGAGGGAGGAGTCGACGAAGGGATTCAAAATGGGGATTTGGTATTATCGGAACCGAGGGCAATATTTGGAAATGAGTCCAAAGGGAGATATTGAATTTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.50%	29.90%	0.00%	0.59%	NA
All Indica	2759	98.30%	1.60%	0.00%	0.14%	NA
All Japonica	1512	10.30%	88.10%	0.00%	1.59%	NA
Aus	269	97.00%	3.00%	0.00%	0.00%	NA
Indica I	595	97.50%	2.20%	0.00%	0.34%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	96.60%	3.20%	0.00%	0.25%	NA
Temperate Japonica	767	3.80%	93.10%	0.00%	3.13%	NA
Tropical Japonica	504	23.20%	76.80%	0.00%	0.00%	NA
Japonica Intermediate	241	4.10%	95.90%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	66.70%	33.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0617344026	T -> C	LOC_Os06g30080-LOC_Os06g30090	intergenic_region ; MODIFIER	silent_mutation	Average:52.201; most accessible tissue: Zhenshan97 young leaf, score: 75.751	N	N	N	N
vg0617344026	T -> DEL	N	N	silent_mutation	Average:52.201; most accessible tissue: Zhenshan97 young leaf, score: 75.751	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0617344026	NA	3.48E-81	mr1080	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026	NA	2.36E-78	mr1100	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026	9.80E-07	9.80E-07	mr1165	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026	NA	2.71E-09	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026	NA	5.82E-37	mr1402	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026	NA	4.22E-20	mr1477	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026	NA	1.83E-65	mr1619	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026	NA	3.96E-37	mr1719	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026	NA	9.41E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026	NA	5.36E-19	mr1165_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026	NA	9.70E-31	mr1477_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026	NA	1.49E-17	mr1682_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026	NA	4.66E-21	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026	NA	1.43E-21	mr1971_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026	2.65E-06	2.65E-06	mr1971_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251