\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617344026:

Variant ID: vg0617344026 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17344026
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAAATTCAATATCTCCCTTTGGACTCATTTCCAAATATTGCCCTCGGTTCCGATAATACCAAATCCCCATTTTGAATCCCTTCGTCGACTCCTCCCTCT[T/C]
CCCCAAATCCAAAAATAACCGAGTCCACCTTGAATCTATTCCTTGGCTCCTCCGTATTTCGCTAAGTTCAAATATGCAATTTGAATTCAAACCTAAACTC

Reverse complement sequence

GAGTTTAGGTTTGAATTCAAATTGCATATTTGAACTTAGCGAAATACGGAGGAGCCAAGGAATAGATTCAAGGTGGACTCGGTTATTTTTGGATTTGGGG[A/G]
AGAGGGAGGAGTCGACGAAGGGATTCAAAATGGGGATTTGGTATTATCGGAACCGAGGGCAATATTTGGAAATGAGTCCAAAGGGAGATATTGAATTTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.50% 29.90% 0.00% 0.59% NA
All Indica  2759 98.30% 1.60% 0.00% 0.14% NA
All Japonica  1512 10.30% 88.10% 0.00% 1.59% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 97.50% 2.20% 0.00% 0.34% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 3.20% 0.00% 0.25% NA
Temperate Japonica  767 3.80% 93.10% 0.00% 3.13% NA
Tropical Japonica  504 23.20% 76.80% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617344026 T -> C LOC_Os06g30080-LOC_Os06g30090 intergenic_region ; MODIFIER silent_mutation Average:52.201; most accessible tissue: Zhenshan97 young leaf, score: 75.751 N N N N
vg0617344026 T -> DEL N N silent_mutation Average:52.201; most accessible tissue: Zhenshan97 young leaf, score: 75.751 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617344026 NA 3.48E-81 mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026 NA 2.36E-78 mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026 9.80E-07 9.80E-07 mr1165 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026 NA 2.71E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026 NA 5.82E-37 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026 NA 4.22E-20 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026 NA 1.83E-65 mr1619 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026 NA 3.96E-37 mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026 NA 9.41E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026 NA 5.36E-19 mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026 NA 9.70E-31 mr1477_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026 NA 1.49E-17 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026 NA 4.66E-21 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026 NA 1.43E-21 mr1971_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617344026 2.65E-06 2.65E-06 mr1971_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251