\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617335611:

Variant ID: vg0617335611 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17335611
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTAAAGCCGATACAGCCGATTTCGACAATATGACTTGTACACGACATCGGGTTCAAGTTAATGTACTTCAAGATGATTGCCACGCACGGATAGAGTCCT[A/G]
GGAAGGCAATTGTATCTATTAATTAAGATATCTTATGTAAATTCCTTATAGATAAATATGGGCAAAAGTCTGCCGCAAAGACTTATGGTATCTTAGAGTT

Reverse complement sequence

AACTCTAAGATACCATAAGTCTTTGCGGCAGACTTTTGCCCATATTTATCTATAAGGAATTTACATAAGATATCTTAATTAATAGATACAATTGCCTTCC[T/C]
AGGACTCTATCCGTGCGTGGCAATCATCTTGAAGTACATTAACTTGAACCCGATGTCGTGTACAAGTCATATTGTCGAAATCGGCTGTATCGGCTTTACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.60% 33.20% 12.93% 5.35% NA
All Indica  2759 71.50% 3.20% 16.64% 8.66% NA
All Japonica  1512 6.20% 90.30% 3.31% 0.20% NA
Aus  269 65.40% 7.10% 25.28% 2.23% NA
Indica I  595 66.90% 3.20% 21.18% 8.74% NA
Indica II  465 64.70% 1.30% 20.65% 13.33% NA
Indica III  913 81.80% 1.60% 10.08% 6.46% NA
Indica Intermediate  786 67.00% 6.10% 18.45% 8.40% NA
Temperate Japonica  767 2.20% 96.70% 0.78% 0.26% NA
Tropical Japonica  504 14.10% 77.80% 7.94% 0.20% NA
Japonica Intermediate  241 2.50% 95.90% 1.66% 0.00% NA
VI/Aromatic  96 17.70% 59.40% 21.88% 1.04% NA
Intermediate  90 38.90% 42.20% 14.44% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617335611 A -> G LOC_Os06g30080.1 upstream_gene_variant ; 508.0bp to feature; MODIFIER silent_mutation Average:18.985; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 N N N N
vg0617335611 A -> G LOC_Os06g30070.1 downstream_gene_variant ; 3964.0bp to feature; MODIFIER silent_mutation Average:18.985; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 N N N N
vg0617335611 A -> G LOC_Os06g30080-LOC_Os06g30090 intergenic_region ; MODIFIER silent_mutation Average:18.985; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 N N N N
vg0617335611 A -> DEL N N silent_mutation Average:18.985; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617335611 NA 3.62E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617335611 NA 9.50E-29 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617335611 2.11E-06 NA mr1164 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617335611 NA 5.83E-15 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617335611 NA 9.88E-31 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617335611 NA 1.49E-13 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617335611 NA 1.29E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617335611 NA 4.87E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617335611 NA 6.29E-54 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617335611 NA 6.68E-19 mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617335611 NA 6.78E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251