Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617335611:

Variant ID: vg0617335611 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 17335611
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTAAAGCCGATACAGCCGATTTCGACAATATGACTTGTACACGACATCGGGTTCAAGTTAATGTACTTCAAGATGATTGCCACGCACGGATAGAGTCCT[A/G]
GGAAGGCAATTGTATCTATTAATTAAGATATCTTATGTAAATTCCTTATAGATAAATATGGGCAAAAGTCTGCCGCAAAGACTTATGGTATCTTAGAGTT

Reverse complement sequence

AACTCTAAGATACCATAAGTCTTTGCGGCAGACTTTTGCCCATATTTATCTATAAGGAATTTACATAAGATATCTTAATTAATAGATACAATTGCCTTCC[T/C]
AGGACTCTATCCGTGCGTGGCAATCATCTTGAAGTACATTAACTTGAACCCGATGTCGTGTACAAGTCATATTGTCGAAATCGGCTGTATCGGCTTTACT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.60%	33.20%	12.93%	5.35%	NA
All Indica	2759	71.50%	3.20%	16.64%	8.66%	NA
All Japonica	1512	6.20%	90.30%	3.31%	0.20%	NA
Aus	269	65.40%	7.10%	25.28%	2.23%	NA
Indica I	595	66.90%	3.20%	21.18%	8.74%	NA
Indica II	465	64.70%	1.30%	20.65%	13.33%	NA
Indica III	913	81.80%	1.60%	10.08%	6.46%	NA
Indica Intermediate	786	67.00%	6.10%	18.45%	8.40%	NA
Temperate Japonica	767	2.20%	96.70%	0.78%	0.26%	NA
Tropical Japonica	504	14.10%	77.80%	7.94%	0.20%	NA
Japonica Intermediate	241	2.50%	95.90%	1.66%	0.00%	NA
VI/Aromatic	96	17.70%	59.40%	21.88%	1.04%	NA
Intermediate	90	38.90%	42.20%	14.44%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0617335611	A -> G	LOC_Os06g30080.1	upstream_gene_variant ; 508.0bp to feature; MODIFIER	silent_mutation	Average:18.985; most accessible tissue: Zhenshan97 flag leaf, score: 27.583	N	N	N	N
vg0617335611	A -> G	LOC_Os06g30070.1	downstream_gene_variant ; 3964.0bp to feature; MODIFIER	silent_mutation	Average:18.985; most accessible tissue: Zhenshan97 flag leaf, score: 27.583	N	N	N	N
vg0617335611	A -> G	LOC_Os06g30080-LOC_Os06g30090	intergenic_region ; MODIFIER	silent_mutation	Average:18.985; most accessible tissue: Zhenshan97 flag leaf, score: 27.583	N	N	N	N
vg0617335611	A -> DEL	N	N	silent_mutation	Average:18.985; most accessible tissue: Zhenshan97 flag leaf, score: 27.583	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0617335611	NA	3.62E-27	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617335611	NA	9.50E-29	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617335611	2.11E-06	NA	mr1164	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617335611	NA	5.83E-15	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617335611	NA	9.88E-31	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617335611	NA	1.49E-13	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617335611	NA	1.29E-08	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617335611	NA	4.87E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617335611	NA	6.29E-54	mr1861	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617335611	NA	6.68E-19	mr1165_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617335611	NA	6.78E-09	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251