\
| Variant ID: vg0617335611 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 17335611 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGTAAAGCCGATACAGCCGATTTCGACAATATGACTTGTACACGACATCGGGTTCAAGTTAATGTACTTCAAGATGATTGCCACGCACGGATAGAGTCCT[A/G]
GGAAGGCAATTGTATCTATTAATTAAGATATCTTATGTAAATTCCTTATAGATAAATATGGGCAAAAGTCTGCCGCAAAGACTTATGGTATCTTAGAGTT
AACTCTAAGATACCATAAGTCTTTGCGGCAGACTTTTGCCCATATTTATCTATAAGGAATTTACATAAGATATCTTAATTAATAGATACAATTGCCTTCC[T/C]
AGGACTCTATCCGTGCGTGGCAATCATCTTGAAGTACATTAACTTGAACCCGATGTCGTGTACAAGTCATATTGTCGAAATCGGCTGTATCGGCTTTACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.60% | 33.20% | 12.93% | 5.35% | NA |
| All Indica | 2759 | 71.50% | 3.20% | 16.64% | 8.66% | NA |
| All Japonica | 1512 | 6.20% | 90.30% | 3.31% | 0.20% | NA |
| Aus | 269 | 65.40% | 7.10% | 25.28% | 2.23% | NA |
| Indica I | 595 | 66.90% | 3.20% | 21.18% | 8.74% | NA |
| Indica II | 465 | 64.70% | 1.30% | 20.65% | 13.33% | NA |
| Indica III | 913 | 81.80% | 1.60% | 10.08% | 6.46% | NA |
| Indica Intermediate | 786 | 67.00% | 6.10% | 18.45% | 8.40% | NA |
| Temperate Japonica | 767 | 2.20% | 96.70% | 0.78% | 0.26% | NA |
| Tropical Japonica | 504 | 14.10% | 77.80% | 7.94% | 0.20% | NA |
| Japonica Intermediate | 241 | 2.50% | 95.90% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 17.70% | 59.40% | 21.88% | 1.04% | NA |
| Intermediate | 90 | 38.90% | 42.20% | 14.44% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0617335611 | A -> G | LOC_Os06g30080.1 | upstream_gene_variant ; 508.0bp to feature; MODIFIER | silent_mutation | Average:18.985; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 | N | N | N | N |
| vg0617335611 | A -> G | LOC_Os06g30070.1 | downstream_gene_variant ; 3964.0bp to feature; MODIFIER | silent_mutation | Average:18.985; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 | N | N | N | N |
| vg0617335611 | A -> G | LOC_Os06g30080-LOC_Os06g30090 | intergenic_region ; MODIFIER | silent_mutation | Average:18.985; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 | N | N | N | N |
| vg0617335611 | A -> DEL | N | N | silent_mutation | Average:18.985; most accessible tissue: Zhenshan97 flag leaf, score: 27.583 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0617335611 | NA | 3.62E-27 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617335611 | NA | 9.50E-29 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617335611 | 2.11E-06 | NA | mr1164 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617335611 | NA | 5.83E-15 | mr1165 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617335611 | NA | 9.88E-31 | mr1202 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617335611 | NA | 1.49E-13 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617335611 | NA | 1.29E-08 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617335611 | NA | 4.87E-10 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617335611 | NA | 6.29E-54 | mr1861 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617335611 | NA | 6.68E-19 | mr1165_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0617335611 | NA | 6.78E-09 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |