Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617331761:

Variant ID: vg0617331761 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 17331761
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGATGCATGACAGCCAATGTGTTTACATCGCCTTCAGATAGCCGATATTGTTATATCGCCCTTAATTGTTTTTTCCTGGTGTAATCTGTTGTGGTTTGC[T/C]
GATATACAATGGCCGATATTGTTCTATCGCCCTTAGTTGTTATATAATTTTATCAATGCTCTTGACATTGTAAAACTAGGGGGGGCACATATATAAAAAA

Reverse complement sequence

TTTTTTATATATGTGCCCCCCCTAGTTTTACAATGTCAAGAGCATTGATAAAATTATATAACAACTAAGGGCGATAGAACAATATCGGCCATTGTATATC[A/G]
GCAAACCACAACAGATTACACCAGGAAAAAACAATTAAGGGCGATATAACAATATCGGCTATCTGAAGGCGATGTAAACACATTGGCTGTCATGCATCGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.40%	30.40%	0.15%	0.13%	NA
All Indica	2759	98.20%	1.70%	0.07%	0.00%	NA
All Japonica	1512	10.20%	89.10%	0.33%	0.40%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	97.50%	2.40%	0.17%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	96.40%	3.40%	0.13%	0.00%	NA
Temperate Japonica	767	3.50%	95.00%	0.65%	0.78%	NA
Tropical Japonica	504	23.20%	76.80%	0.00%	0.00%	NA
Japonica Intermediate	241	4.10%	95.90%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	66.70%	33.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0617331761	T -> C	LOC_Os06g30070.1	downstream_gene_variant ; 114.0bp to feature; MODIFIER	silent_mutation	Average:37.262; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg0617331761	T -> C	LOC_Os06g30080.1	downstream_gene_variant ; 142.0bp to feature; MODIFIER	silent_mutation	Average:37.262; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg0617331761	T -> C	LOC_Os06g30070-LOC_Os06g30080	intergenic_region ; MODIFIER	silent_mutation	Average:37.262; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N
vg0617331761	T -> DEL	N	N	silent_mutation	Average:37.262; most accessible tissue: Zhenshan97 flag leaf, score: 64.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0617331761	NA	1.20E-21	mr1020	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761	NA	1.20E-19	mr1021	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761	NA	4.46E-80	mr1080	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761	NA	6.59E-78	mr1100	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761	3.79E-06	3.79E-06	mr1165	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761	NA	1.87E-10	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761	NA	1.09E-09	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761	NA	1.56E-35	mr1402	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761	NA	1.76E-21	mr1477	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761	NA	1.48E-17	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761	NA	9.63E-75	mr1629	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761	NA	9.62E-37	mr1719	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761	3.71E-06	3.81E-35	mr1780	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761	NA	5.98E-21	mr1971	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761	NA	7.95E-19	mr1165_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761	NA	1.62E-30	mr1477_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761	NA	9.56E-27	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761	4.62E-06	4.62E-06	mr1971_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251