\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0617331761:

Variant ID: vg0617331761 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 17331761
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGATGCATGACAGCCAATGTGTTTACATCGCCTTCAGATAGCCGATATTGTTATATCGCCCTTAATTGTTTTTTCCTGGTGTAATCTGTTGTGGTTTGC[T/C]
GATATACAATGGCCGATATTGTTCTATCGCCCTTAGTTGTTATATAATTTTATCAATGCTCTTGACATTGTAAAACTAGGGGGGGCACATATATAAAAAA

Reverse complement sequence

TTTTTTATATATGTGCCCCCCCTAGTTTTACAATGTCAAGAGCATTGATAAAATTATATAACAACTAAGGGCGATAGAACAATATCGGCCATTGTATATC[A/G]
GCAAACCACAACAGATTACACCAGGAAAAAACAATTAAGGGCGATATAACAATATCGGCTATCTGAAGGCGATGTAAACACATTGGCTGTCATGCATCGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.40% 30.40% 0.15% 0.13% NA
All Indica  2759 98.20% 1.70% 0.07% 0.00% NA
All Japonica  1512 10.20% 89.10% 0.33% 0.40% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 97.50% 2.40% 0.17% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 96.40% 3.40% 0.13% 0.00% NA
Temperate Japonica  767 3.50% 95.00% 0.65% 0.78% NA
Tropical Japonica  504 23.20% 76.80% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0617331761 T -> C LOC_Os06g30070.1 downstream_gene_variant ; 114.0bp to feature; MODIFIER silent_mutation Average:37.262; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 N N N N
vg0617331761 T -> C LOC_Os06g30080.1 downstream_gene_variant ; 142.0bp to feature; MODIFIER silent_mutation Average:37.262; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 N N N N
vg0617331761 T -> C LOC_Os06g30070-LOC_Os06g30080 intergenic_region ; MODIFIER silent_mutation Average:37.262; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 N N N N
vg0617331761 T -> DEL N N silent_mutation Average:37.262; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0617331761 NA 1.20E-21 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761 NA 1.20E-19 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761 NA 4.46E-80 mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761 NA 6.59E-78 mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761 3.79E-06 3.79E-06 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761 NA 1.87E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761 NA 1.09E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761 NA 1.56E-35 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761 NA 1.76E-21 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761 NA 1.48E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761 NA 9.63E-75 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761 NA 9.62E-37 mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761 3.71E-06 3.81E-35 mr1780 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761 NA 5.98E-21 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761 NA 7.95E-19 mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761 NA 1.62E-30 mr1477_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761 NA 9.56E-27 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0617331761 4.62E-06 4.62E-06 mr1971_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251